ICT লেকচার শিট (English) Chapter-2 HSC 1st Year 2016-2017
Chapter -2
Data Communication & Computer Network
Definition of communication system: A system that exchange data between persons and
equipment’s or device is called communication system. A communication system is made up of
device that employee one of two communication method (Wireless or wired), different types of
equipment (portable radios, mobile radios, base or fixed station and repeaters) and various
accessories (speaker, microphone, battery eliminators) to meet the user needs.
Another definition of communication system: A system that exchange data between persons
and equipment or device is called communication system
Data communication system: Data communication system is the function of transporting data
from one point another.
Elements of data communication system: A data communication system has five fundamental
elements, such as
i)Data source: Source is the computer where available data are obtained to send; examples are
telephone and computers.
ii)Transmitter: The transmitter is the device that transmits the source data in the
communication medium; example modem.
iii)Medium: The transmission medium is the physical path which a message travels from
transmitter to receiver . It could be twisted pair wire, coaxial cable , fiber optic cable or radio
waves.
iv)Receiver: It is the modem located at destination side that converts received data into
computer readable form or in digital form.
v)Destination: The computer that finally store the incoming message or data is known as
destination.
Download PDF File
HSC & Alim Result 2016 Published
HSC & Alim Result 2016 Published 27 July 2016HSC Result 2016 Bangladesh .
Result Published on 27 July 2016 Published
Educational Board Bangladesh
Entire 11,41,374 examinees join from 8,104 learning organizations all over the Bangladesh. Besides, 606,293 examinees are boys and 535,081 examinees are girls occupied share in HSC Exam 2015 under 10 education boards, plus madrasha and technical boards.
ICT লেকচার শিট Chapter-2 HSC 1st Year 2016-2017
বিশ্বগ্রাম (Global Village)।বিশ্বগ্রামএরপ্রবর্তকমার্শালম্যাকলুহ্যান (জুলাই২১, ১৯১১ – ডিসেম্বর৩১, ১৯৮০)।কানাডিয়ানদার্শনিকহার্ভার্টমার্শালম্যাকলুহ্যানযোগাযোগতত্বেরজনক।তিনিসর্বগ্রথমতাঁররচিত The Gutenberg Galaxy: The Making of Typographic Man (১৯৬২) বইয়েবিশ্বগ্রামেরধারনাদেন।অতঃপর১৯৬৪সালে Understanding Media গ্রন্থেবিশ্বগ্রামসম্পর্কেআরোবিস্তারিতবর্ণনাকরেন।
গ্লোবালভিলেজবাবিশ্বগ্রামেরধারণানতুননয়।দীর্ঘদিনধরেইএইশব্দগুলোব্যবহারকরেআসছিসবাই।তবেসত্যিকারেরগ্লোবালভিলেজবাবিশ্বগ্রামবোঁধহয়বলাযায়ইন্টারনেটেরভার্চুয়ালজগতটাকেই।দেশ, জাতি, ধর্ম, বর্ণ, বয়সনির্বিশেষেইন্টারনেটেরভার্চুয়ালপ্ল্যাটফর্মেযুক্তএখনবিশ্বেরএক-তৃতীয়াংশেরওবেশিমানুষ।
সামাজিকযোগাযোগেরওয়েবসাইটগুলোরকল্যাণেগোটাবিশ্বএখনঅনেকবেশিকাছাকাছিচলেএসেছে।ফেসবুক, টুইটার, ফ্লিকার, ইন্সটাগ্রাম, পিনটারেস্ট, টাম্বলার, সাউন্ডক্লাউডআরইউটিউবেরকল্যাণেগোটাবিশ্বএখনপরিণতহয়েছেশেয়ারিংয়েরস্থানে।বিশেষকরেতরুণদেরমধ্যেএসবসামাজিকযোগাযোগেরওয়েবসাইটএবংসার্ভিসপেয়েছেঅসামান্যজনপ্রিয়তা।
মার্কিনলেখকএলভিনটফলারের (১৯৮১) ‘তৃতীয়জোয়ার’ বাতথ্যনির্ভরসমাজব্যবস্থায়আমাদেরবসবাস।তিনিবলেছেন, সভ্যতাগুলোরতিনটিপ্রধানজোয়ারবাবৈশিষ্ট্যআছে।কৃষিকাজছিলসভ্যতারপ্রথমজোয়ার, আরদ্বিতীয়জোয়ারগড়েওঠেশিল্পায়নেরমাধ্যমে।টফলারেরমতে, এইদুইজোয়ারম্লানহয়েআসছেএবংপৃথিবীরভবিষ্যৎগতিপথস্পষ্টহয়েউঠেছেতৃতীয়জোয়ারেরকারণে।এইতৃতীয়জোয়ারহলোইলেকট্রনিকসভ্যতাবাতথ্যযুগ, যেটিপরিপূর্ণতাপেয়েছেইন্টারনেটেরবদৌলতে। কানাডীয়চিন্তাবিদওযোগাযোগবিশেষজ্ঞমার্শালম্যাকলুহান (১৯৬৪) যে ‘গ্লোবালভিলেজবাবিশ্বগ্রাম’ ধারণারকথাবলেছিলেনতারমূলনায়কএখনইন্টারনেট।আধুনিকসমাজেজুতাসেলাইথেকেচণ্ডিপাঠপর্যন্তসবকিছুযেতথ্যকেঘিরেআবর্তিতহচ্ছেতারসবচেয়েবড়শক্তিএখনইন্টারনেট।এইইন্টারনেটেরউপরভিত্তিকরেতৈরিহয়েছেঅনলাইনগণমাধ্যমেরসুবৃহৎপরিসর।সময়, স্থানইত্যাদিরচিরাচরিতপ্রতিবন্ধকতাকেজয়করেতাৎক্ষণিকতারভিত্তিতেপ্রতিনিয়তনির্মিতকিংবাবিনির্মিতহচ্ছেঅনলাইনগণমাধ্যমেরদর্শন।
প্রতিনিয়তনতুননতুনবৈশিষ্ট্যসন্নিবেশিতহওয়ায়অনলাইনগণমাধ্যমেরসীমারেখানির্ধারণকরাগণমাধ্যমচিন্তকদেরজন্যকঠিনহয়েপড়ছে।সনাতনগণমাধ্যমেরবৈশিষ্ট্যগুলোকেধারণকরেইপ্রকৃতঅর্থেঅনলাইনগণমাধ্যমতারপরিসরনির্মাণকরেছে।একারণেকোনোকোনোগণমাধ্যম-পণ্ডিতনয়াপ্রযুক্তিনির্ভরএমাধ্যমটিকে ‘ম্যাসমাল্টিমিডিয়া’ (McAdams, 2005) হিসেবেআখ্যায়িতকরছেন।অর্থাৎসংবাদপত্রেরটেক্সট, ছবিকিংবারেডিও’রশব্দএবংটেলিভিশনেরভিডিওচিত্রসবকিছুইএকইসাথেপাওয়াযাচ্ছেঅনলাইনগণমাধ্যমে।আরোস্পষ্টকরেবললে,ICT বিশ্বগ্রাম লেকচার শিট (Global Village) HSC 1st year 2016 Chaptar 1
বিশ্বগ্রাম (Global Village)বিশ্বগ্রাম (Global Village)। বিশ্বগ্রাম এর প্রবর্তক মার্শাল ম্যাকলুহ্যান (জুলাই ২১, ১৯১১ – ডিসেম্বর ৩১, ১৯৮০)। কানাডিয়ান দার্শনিক হার্ভার্ট মার্শাল ম্যাকলুহ্যান যোগাযোগ তত্বের জনক। তিনি সর্বগ্রথম তাঁর রচিত The Gutenberg Galaxy: The Making of Typographic Man (১৯৬২) বইয়ে বিশ্বগ্রামের ধারনা দেন। অতঃপর ১৯৬৪ সালে Understanding Media গ্রন্থে বিশ্বগ্রাম সম্পর্কে আরো বিস্তারিত বর্ণনা করেন।
গ্লোবাল ভিলেজ বা বিশ্বগ্রামের ধারণা নতুন নয়। দীর্ঘদিন ধরেই এই শব্দগুলো ব্যবহার করে আসছি সবাই। তবে সত্যিকারের গ্লোবাল ভিলেজ বা বিশ্বগ্রাম বোঁধহয় বলা যায় ইন্টারনেটের ভার্চুয়াল জগতটাকেই। দেশ, জাতি, ধর্ম, বর্ণ, বয়স নির্বিশেষে ইন্টারনেটের ভার্চুয়াল প্ল্যাটফর্মে যুক্ত এখন বিশ্বের এক-তৃতীয়াংশেরও বেশি মানুষ।
সামাজিক যোগাযোগের ওয়েবসাইটগুলোর কল্যাণে গোটা বিশ্ব এখন অনেক বেশি কাছাকাছি চলে এসেছে। ফেসবুক, টুইটার, ফ্লিকার, ইন্সটাগ্রাম, পিনটারেস্ট, টাম্বলার, সাউন্ড ক্লাউড আর ইউটিউবের কল্যাণে গোটা বিশ্ব এখন পরিণত হয়েছে শেয়ারিংয়ের স্থানে। বিশেষ করে তরুণদের মধ্যে এসব সামাজিক যোগাযোগের ওয়েবসাইট এবং সার্ভিস পেয়েছে অসামান্য জনপ্রিয়তা।
মার্কিন লেখক এলভিন টফলারের (১৯৮১) ‘তৃতীয় জোয়ার’ বা তথ্যনির্ভর সমাজব্যবস্থায় আমাদের বসবাস। তিনি বলেছেন, সভ্যতাগুলোর তিনটি প্রধান জোয়ার বা বৈশিষ্ট্য আছে। কৃষিকাজ ছিল সভ্যতার প্রথম জোয়ার, আর দ্বিতীয় জোয়ার গড়ে ওঠে শিল্পায়নের মাধ্যমে। টফলারের মতে, এই দুই জোয়ার ম্লান হয়ে আসছে এবং পৃথিবীর ভবিষ্যৎ গতিপথ স্পষ্ট হয়ে উঠেছে তৃতীয় জোয়ারের কারণে। এই তৃতীয় জোয়ার হলো ইলেকট্রনিক সভ্যতা বা তথ্য যুগ, যেটি পরিপূর্ণতা পেয়েছে ইন্টারনেটের বদৌলতে। কানাডীয় চিন্তাবিদ ও যোগাযোগ বিশেষজ্ঞ মার্শাল ম্যাকলুহান (১৯৬৪) যে ‘গ্লোবাল ভিলেজ বা বিশ্বগ্রাম’ ধারণার কথা বলেছিলেন তার মূলনায়ক এখন ইন্টারনেট। আধুনিক সমাজে জুতা সেলাই থেকে চণ্ডিপাঠ পর্যন্ত সবকিছু যে তথ্যকে ঘিরে আবর্তিত হচ্ছে তার সবচেয়ে বড় শক্তি এখন ইন্টারনেট। এই ইন্টারনেটের উপর ভিত্তি করে তৈরি হয়েছে অনলাইন গণমাধ্যমের সুবৃহৎ পরিসর। সময়, স্থান ইত্যাদির চিরাচরিত প্রতিবন্ধকতাকে জয় করে তাৎক্ষণিকতার ভিত্তিতে প্রতিনিয়ত নির্মিত কিংবা বিনির্মিত হচ্ছে অনলাইন গণমাধ্যমের দর্শন।
প্রতিনিয়ত নতুন নতুন বৈশিষ্ট্য সন্নিবেশিত হওয়ায় অনলাইন গণমাধ্যমের সীমারেখা নির্ধারণ করা গণমাধ্যম চিন্তকদের জন্য কঠিন হয়ে পড়ছে। সনাতন গণমাধ্যমের বৈশিষ্ট্যগুলোকে ধারণ করেই প্রকৃতঅর্থে অনলাইন গণমাধ্যম তার পরিসর নির্মাণ করেছে। এ কারণে কোনো কোনো গণমাধ্যম-পণ্ডিত নয়া প্রযুক্তিনির্ভর এ মাধ্যমটিকে ‘ম্যাস মাল্টিমিডিয়া’ (McAdams, 2005) হিসেবে আখ্যায়িত করছেন। অর্থাৎ সংবাদপত্রের টেক্সট, ছবি কিংবা রেডিও’র শব্দ এবং টেলিভিশনের ভিডিও চিত্র সবকিছুই একইসাথে পাওয়া যাচ্ছে অনলাইন গণমাধ্যমে। আরো স্পষ্ট করে বললে, কোনো একটি সংবাদ সাইট থেকে অডিয়েন্স নির্দিষ্ট একটি সংবাদ যেমন পাঠ করতে পারেন একই সাথে পডকাস্টিং সুবিধার কারণে সেই সংক্রান্ত খবর শুনতে এবং ব্রডকাস্টিংয়ের মাধ্যমে তার ভিডিও ফুটেজ দেখতে পারেন। একটি মাধ্যমে সনাতন গণমাধ্যমগুলোর এমন সংমিশ্রণ সম্ভব করে তুলেছে অনলাইন প্রযুক্তি। এ যেন জন মিল্টন থেকে লক কিংবা ম্যাডিসন থেকে স্টুয়ার্ট মিলের বাক-স্বাধীনতার চরম বহিঃপ্রকাশ।
বিশ্বগ্রামের উপাদান গুলো
যোগাযোগ
কর্মসংস্থান
শিক্ষা
চিকিৎসা
গবেষণা
অফিস
বাসস্থান
ব্যবসা-বানিজ্য
সংবাদ
বিনোদন ও সামাজিক যোগাযোগ
সাংস্কৃতিক বিনিময়
এছাড়াও আরো অনেক উপাদান রয়েছে বিশ্বগ্রামে। নিম্নে উপাদান সমূহের কিছু বর্ণনা দেয়া হলো-
যোগাযোগঃ বিশ্বগ্রামে যোগাযোগ হলো এর প্রধান উপাদান। যোগাযোগ মানে তথ্য আদান প্রদানের উপায়। মানুষ থেকে মানুষ বা যন্ত্র থেকে যন্ত্রে তথ্য আদান প্রদান হতে পারে। মাধ্যম-ও হতে পারে শব্দ, বিদ্যুৎ, তড়িৎচৌম্বক বিকিরণ (আলো বা রেডিও-ওয়েভ)।
তথ্য ও যোগাযোগ প্রযুক্তির মাধ্যমে দেশ-মহাদেশ, জাতি-বর্ণ নির্বিশেষে সকলের সাথে যোগাযোগ এতোটাই সহজ হয়েছে যে, মানুষে মানুষে যোগাযোগ করার জন্য এখন সু-দূর দেশে পারি দিতে হয় না। কেবল মাত্র একটি ফোন ডায়াল বা নেট ডায়ালের মাধ্যমেই সম্ভব হয় মূহুর্তের মধ্যেই।
যোগাযোগের মাধ্যমগুলো মানুষকে নিজ ভুবনকেন্দ্রিক ভাবনার তাড়না যোগাচ্ছে কিনা, তা নিয়ে একটা সন্দেহ-সংশয় বিশেষজ্ঞদের বেশ কিছুদিন যাবতই ছিল। আর সম্প্রতি এই সন্দেহের যথেষ্ট ভিত্তি আছে বলে জানান দিয়েছেন গবেষকরা। তাঁদের দাবি অনুসারে, একটা মানুষ কতখানি আত্মকেন্দ্রিক সেটা তার ফেসবুকের বন্ধু সংখ্যা এবং এর অন্যান্য ব্যবহার দেখে অনুমান করা সম্ভব। শুধু তাই না, ফেসবুক ব্যবহারকারীদের মাধ্যমে গ্রীক দেবতা নার্সিসাস আবার নতুনভাবে ফিরে আসছেন বলে বলেও মন্তব্য করেছেন ওয়েস্টার্ন ইলিনিয়স বিশ্ববিদ্যালয়ের এই গবেষকরা।
কর্মসংস্থানঃ তথ্যপ্রযুক্তি বিশেষত ইন্টারনেটের কল্যাণে বিশ্ব আজ আমাদের হাতের মুঠোয় চলে এসেছে। বাংলাদেশের প্রত্যন্ত অঞ্চলের কোনো গণমাধ্যমের খবর মুহুর্তেই ছড়িয়ে পড়ছে বিশ্বব্যাপী। তেমনি আমরাও বিভিন্ন দেশের বিভিন্ন স্থানের খবর পাচ্ছি। বিভিন্ন দেশ-মহাদেশের কর্মসংস্থানের সকল খবরাখবর পেয়ে যাই।
শিক্ষাঃ ইংরেজি ভাষায় শিক্ষার প্রতিশব্দ হলো Education. Education শব্দের সাধারণ আভিধানিক অর্থ হলো : শিক্ষাদান ও প্রতিপালন, শিক্ষাদান, । Educate মানে : to bring up and instruct, to teach, to train অর্থাৎ প্রতিপালন করা ও শিক্ষিত করিয়া তোলা, শিক্ষা দেওয়া, অভ্যাস করানো।
শিক্ষার মানোন্নয়নে ‘শিক্ষকদের দ্বারা ডিজিটাল কন্টেন্ট তৈরি’ আরেকটি উল্লেখ করার মতো বিষয়। ডিজিটাল কনটেন্ট হলো পাঠ্যপুস্তকে
চিকিৎসাঃ তথ্য ও যোগাযোগ প্রযুক্তির উন্নতির ফলে চিকিৎসা শাস্র হয়ে গেছে এখন চিকিৎসা বিজ্ঞান। চিকিৎসা বিজ্ঞান বা চিকিৎসা শাস্ত্র হল রোগ উপশমের বিজ্ঞান কলা বা শৈলী। মানব শরীর এবং মানব স্বাস্থ্য ভালো রাখার উদ্দেশ্যে রোগ নিরাময় ও রোগ প্রতিষেধক বিষয়ে চিকিৎসা বিজ্ঞানে অধ্যায়ন করা হয় এবং প্রয়োজন অনুসারে বিভিন্ন পদ্ধতি ব্যবহার করা হয়। সমসাময়িক চিকিৎসা বিজ্ঞানে স্বাস্থ্য বিজ্ঞান অধ্যয়ন, গৱেষণা, এবং সংশ্লিষ্ট প্রযুক্তিবিদ্যার ব্যবহার করে লব্ধ জ্ঞানের মাধ্যমে ঔষধ বা শল্য চিকিৎসার দ্বারা রোগ নিরাময় করার চেষ্টা করা হয়।ঔষধ বা শল্য চিকিৎসা ছাড়াও মনোচিকিৎসা (psychotherapy), কৃত্রিম অঙ্গ সংস্থাপন, আনবিক রশ্মির প্রয়োগ, বিভিন্ন বাহ্যিক উপায় (যেমন, স্প্লিণ্ট (Splint) এবং ট্রাকশন),জৈবিক সামগ্রি (রক্ত, অণু জীব ইত্যাদি), শক্তি্র অন্যান্য উৎস (বিদ্যুৎ, চুম্বক, অতি-শব্দ ইত্যাদি) ইত্যাদিরও প্রয়োগ করা হয়।
অধুনিক চিকিৎসা বিজ্ঞানে বিশ্বগ্রামের ভুমিকা অনেক। ঘরে বসে নিন অনলাইন চিকিৎসা সেবা প্রধান করছে বিভিন্ন ডাক্তারগণ। দেশ থেকে বিদেশে আবার বিদেশ থেকে দেশে আবার দেশ থেকে দেশে এ সেবা প্রদান করা হয়। এতে বিশ্বগ্রামের ভূমিকাই পুরোটা।
গবেষণাঃ গবেষণা (ইংরেজি: Research) হল মানুষের বুদ্ধিবৃত্তিক অনুসন্ধান প্রক্রিয়া এবং নতুন কিছু আবিষ্কারের নেশায় বিজ্ঞানীদের কার্যাবলী। যিনি গবেষণা করেন বা গবেষণা কর্মের সাথে জড়িত, তিনি গবেষক বা গবেষণাকারী নামে পরিচিত।
অফিসঃ অফিস ব্যবস্থাপনায় তথ্য-প্রযুক্তির ব্যবহার বর্তমানে পূর্বের সকল রেকর্ড ছাডিয়ে গেছে। বর্তমান অফিস ব্যবস্থাপনায় তথ্য প্রযুক্তির ব্যবহারের মাধ্যমে দেনন্দিন কাজকে আরো সহজ-সরল ও সাবলীল করে তুলেছে। বিশ্বগ্রামের ধারণা অফিস ব্যবস্থাকে করেছে আরো সমৃদ্ধ ও দক্ষ কার্য পরিধির ধারা।
।
ব্যবসা বানিজ্যঃ দিন দিন প্রযুক্তি সহজতর করেছে জীবনের প্রতিটি কাজ। বিনোদন থেকে শুরু করে দাপ্রিক কোনো কাজই আর প্রযুক্তির বাইরে নয়। একই ভাবে বেশ কিছুদিন আগেই আমাদের ব্যবসায়-বাণিজ্যে যুক্ত হয়েছে এই আধুনিক মাধ্যমটি। ফলে দিন দিন বাড়ছে ই-বাণিজ্যের প্রসার। বিভিন্ন সীমাবদ্ধতা স্বত্বেও বাংলাদেশে ইতিমধ্যে কিছু ই-বাণিজ্য ওয়েবসাইট গড়ে উঠেছে। ই-বাণিজ্যকে কাজে লাগিয়ে বাংলাদেশ একদিকে যেমন ব্যবসা-বাণিজ্যের প্রভূত উন্নতি করা সম্ভব তেমনি একই সাথে কর্মসংস্থানের ক্ষেত্রেও যুক্ত হয়েছে অমিত সম্ভাবনা আর সমৃদ্ধির সুযোগ।
দেশের ব্যবসা-বাণিজ্যের আপডেট তথ্য ভিক্তিক ওয়েব পোটাল এড্রেস বাজার ডট কম্। তথ্য প্রযুক্তির যুগে মানুষের জীবন যাত্রার গতি আরো বাড়িয়ে দিতে এই ওয়েব পোর্টালে রয়েছে শ্রেণীবিন্যাস অনুসারে ব্যবসা-বানিজ্যের তথ্য। এখান হতে নিজস্ব সার্চ ব্যবস্থার মাধ্যমে যে কোন প্রতিষ্টানকে এক নিমিষেই খুজে পাওয়া যাবে।
ইলেকট্রনিক কমার্স কে সংক্ষেপে ই-কমার্স বলা হয়। এটি একটি আধুনিক ব্যবসা পদ্ধতি। ইন্টারনেটের মাধ্যমে এ ব্যবসা এবং লেনদেন পরিচালিত হয়ে থাকে। বস্তুত ইলেকট্রনিক কমার্স হচ্ছে ডিজিটাল ডাটা প্রসেসিং এবং ট্রান্সমিশনের মাধ্যমে কোন ব্যক্তি বা প্রতিষ্ঠানের ব্যবসা সংক্রান্ত আদান প্রদান। সাধারণত এ কাজটি সম্পাদন করা হয় সবার জন্য উন্মুক্ত একটি নেটওয়ার্ক তথা ইন্টারনেটের মাধ্যমে। তাই বলা যায় ইন্টারনেটের মাধ্যমে কোন ব্যক্তি বা প্রতিষ্ঠানের ব্যবসা সংক্রান্ত আদান প্রদান বা লেনদেন করার প্রক্রিয়াই হলো ই-কমার্স।
সংবাদঃ শতাব্দী ধরে মানুষের কাছে সংবাদ ও তথ্য সরবরাহ করার জন্য ছাপার মাধ্যম ব্যবহৃত হয়ে আসছে। সবচেয়ে প্রাচীন সংবাদপত্র হলো, রোমের ‘অ্যাক্টা দিউরনা’ (Acta Diurna), প্রকাশিত হয় ৫৯ খ্রীস্ট-পূর্বাব্দে। জনগণকে গুরুত্বপূর্ণ সামাজিক ও রাজনৈতিক ঘটনাবলী অবহিত করার জন্যে জুলিয়াস সিজার প্রধান শহরগুলোতে সংবাদ প্রেরণের ব্যবস্থা করতে চাইলেন। বিশাল সাদা বোর্ডের এই ‘অ্যাক্টা’ সরকারের স্ক্যানডালস, মিলিটারি ক্যামপেইন কিংবা বিচার ও মৃত্যুদণ্ডের সংবাদ লিখে প্রদর্শনের জন্য রাখা হতো বাথের মতো জনবহুল শহরগুলোতে। সর্বপ্রথম সংবাদপত্র প্রকাশিত হয় অষ্টম শতাব্দীর চীনে। হাতের লেখা সংবাদ-সম্বলিত কাগজ বিলি করা হতো বেইজিংয়ে ।
র্ভাচুয়াল রিয়েলিটি (Virtual Reality)
সংজ্ঞাঃ
ভার্চুয়াল রিয়েলিটি হল কম্পিউটার এবং বিভিন্ন প্রকার সেন্সর এর সমন্বয়ে গঠিত একটি পরিবেশ যার অস্তিত্ত থাকতে পারে আবার সম্পূর্ণ কাল্পনিক হতে পারে।
সায়েন্সফিকশান গুােলাতে নানা রকম কল্পনার ফানুস ওড়ানো হয়ে থাকে। তবে র্ভাচুয়াল জগৎ এখন আর নিছক কল্পনার বস্তু নয়। ওয়েবে সেকেন্ড লাইফের সফলতা প্রমাণ করে দেয় র্ভাচুয়াল জগতে কত কি করা সম্ভব। র্ভাচুয়াল রিয়েলিটি শুধুমাত্র ভিডিও গেমস বা বিনোদনের কাজেই ব্যববহৃত হচ্ছে না। আমেরিকান সেনাবাহিনী এটির র্পূন ব্যবহার করছে তাদের সেনা সদস্যদের প্রশিক্ষনের কাজে বিমান ওড়ানো, প্যারা ট্রুপি থেকে শুরু করে ট্যাংক কামান নিয়ে যুদ্ধের ময়দানে যুদ্ধ করে বাস্তব যুদ্ধের কাছাকাছি অনুভূতি ও অভিজ্ঞতা অর্জনে র্ভাচুয়াল পরিবেশ কাজে লাগানো হচ্ছে।
অনলাইনে যুক্ত হওয়া মানে পৃথিবীর যেকোন প্রান্তের যেকোন ব্যক্তির সাথে যুক্ত হওয়ার সুবিধাপ্রাপ্ত হওয়া।এই বিষয়টাকে কাজে লাগিয়েই অনলাইন নির্ভর বিভিন্ন ভার্চুয়াল পরিবেশ নিয়ে কাজ করে যাচ্ছেন অনেক গবেষক। সম্প্রতি গুগলও lively নামে ভার্চুয়াল চ্যাটিং সার্ভিস চালু করেছে যেখানে একটি ভার্চুয়াল কক্ষ বা পরিবেশে আপনি বন্ধু-বান্ধব ও আতœীয়-স্বজদের নিয়ে প্রবেশ করতে পারবেন। সেখানে ইচ্ছেমত বস্তু দিয়ে সাজানো, বন্ধুদের সাথে মারামারি, নাচানাচি, আবেগের গ্রাফিক্যাল প্রকাশ ইত্যাদি সম্ভব।
সফটওয়ার জায়ান্ট মাইক্রোসফট সম্প্রতি দটি নতুন প্রযুক্তির জন্য পেটেন্ট আবেদন করেছে।পেটেন্ট আবেদন ভার্চুয়াল বস্তুকে বাস্তবে উপলব্ধি করা সম্ভব হবে এমন নতুন প্রযুক্তির কথা বলা হয়েছে। এর একটি হচ্ছে ভার্চুয়াল রিয়েলিটি গ্লাস ও অপরটি হচ্ছে গেমিং হেলমেট । অবশ্য ভার্চুয়াল রিয়েলিটি গ্লাসের প্রযুক্তিটি গুগল তৈরি করেছে বলে আগেই খবর চাউর হয়েছে। পিসি ম্যাগ এক খবরে জানিয়েছে , ভবিষ্যতের মোবাইল ডিভাইস ও গেম কনসোল এক্সবক্স ৩৬০-এর জন্য নতুন প্রযুক্তির গ্লাস ও হেলমেট তৈরি করবে মাইক্রোসফট।
মাইক্রোসফটের প্রথম পেপটেন্ট আবেদনটিতে এক ধরনের হেলমেটের কথা বলা হয়েছে , যাতে চোখের ওপর গ্লাস বসানো থাকবে। ফলে গেমার নিজেকে গেমের একজন চরিত্র হিসেবে ভাবতে পারবে। দ্বিতীয়টি হচ্ছে, সানগ্লাসের মতো চোখে পরার যন্ত্র। এ গ্লাস হবে স্বচ্ছ যা চোখে ডিসপ্লে হিসেবে ছবি , টেক্সট ও ভিডিও দেখাবে । মাইক্রোসফটের স্মাটফোন , মিডিয়া প্লেয়ার ও অন্যান্য মোবাইল ডিভাইসের মতোই এ গ্লাস বা হেলমেট কাজ করবে ও মাইক্রোসফটের অপারেটিং সিস্টেমে চলবে। প্রযুক্তিপণ্য ছাড়াও মাইক্রোসফটের এ ডিভাইসগুলো সাধারন হেলমেট বা সানগ্লাস হিসেবেও ব্যাবহার করা যাবে। ডিভাইসগুলোর প্রযুক্তি হিসেবে ভার্চুয়াল ইমেজ প্রজেক্টের ব্যবহৃত হবে যা লেজারের সাহায্যে ছবি দেখানোর বিষয়টি নিয়ন্ত্রণ করবে।
উল্লেখ্য মাইক্রোসফট ছাড়াও গুগল এমন প্রযুক্তি নিয়ে কাজ করছে। সম্প্রতি গুগল টার্মিনেটরের মতো দেখতে এইচইউডি গ্লাস তৈরি করছে বলেই খবর রটেছে। অ্যান্ড্রয়েড চালিত এ গ্লাস চোখের ক্ষেত্রে অ্যামোলিড ডিসপ্লে হিসেবে কাজ করবে।
অবশেষে আনুষ্ঠানিকভাবে ‘ভার্চুয়াল রিযেলিটি গ্লাস’ বিষয়ে তথ্য দিয়েছে গুগল। প্রযুক্তিবিশ্বে দীর্ঘদিন ধরেই গুজব চালু ছিল যে ‘ এক্স ল্যাব’ নামে গুগলের কথিত এক গোপন পরীক্ষাগারে তৈরি হচ্ছে গুগলের প্রযুক্তিনির্ভর চশমা ২০১১ সালের ডিসেম্বর মাসে এ গুজব ছড়িয়েছিল । গুগলের তৈরি এ চশমাটি খবই পাতল যা কপালের ওপর লাগিয়ে রাখতে হয়। এর ডার কোনায় বসানো রয়েছে ছোট একটি গ্লাস যার মাধ্যমে ব্যবহারকারীর কাছে তথ্য পৌছায় ।
গুগলের দেওয় ভিডিওতে গুগল গ্লাস পরিধানকারীকে দেখা যাচ্ছে । চশমাধারী তাঁর চোখের সামনে ফটে ওঠা অ্যাপ্লিকেশন কন্ঠস্বরের মাধ্যমে নিয়ন্ত্রণ করে ছবি তোলা, ভিডিও করা , আবহাওয়ার তথ্য জানার মত কাজগুলো করেছেন । প্রযুক্তি বিশ্লেষকেরা ধারণা করছেন, ম্মাটফোন ও ট্যাবলেটে গুগলের অ্যান্ড্রয়েড অপারেটিং সিস্টেম যেভাবে ব্যবহৃত হয় গুগল গ্লাসেও সেই একই অপারেটিং সিস্টেম ব্যবহৃত হয়েছে । সর্বাধুনিক প্রযুক্তির এ চশমা অনেকটাই ‘টার্মিনেটর’ ছবিতে দেখানো ডিসপ্লে অথবা গেমের হেড আপ ডিসপ্লের ( এইচইউডি) মতো।
প্রায় দুই বছর ধরে ‘গুগল গ্লাস ’ নামে একটি প্রকল্পের অধীনে এ গ্লাস তৈরির কাজ করেছে গুগল। আগেভাগেই এ গ্লাস সম্পর্কে জনগণের অভিমত জানতেই তথ্য প্রকাশ করা হয়েছে বলে গুগল কর্মকর্তারা জানিয়েছে। এ বছরই বাজারে আসবে গুগলের এ প্রযুক্তি চশমা। এর দাম হতে পারে ৫০০ ডলার। উল্লেখ্য , গুগলের এক্স ল্যাবে নতুন প্রযুক্তির রোবট ও স্পেস এলিভেটর তৈরির কাজ চলছে বলেও প্রযুক্তি বিশ্বে গুজব রয়েছে।
কৃত্রিম বুদ্ধিমত্তা (Artificial Intelligence)
কৃত্রিম বুদ্ধিমত্তার (Artificial Intelligence) জনক ব্রিটিশ গনিতবিদ অ্যালান টিউরিংও বুদ্ধিমত্তার সংজ্ঞা কি তা নিরুপণ করতে পারবেন বলে মনে করেননি, বা এ নিয়ে কারোর সাথে বিতর্কেও যেতে চাননি। বুদ্ধিমত্তা কাকে বলে, তা একটি বহুল বিতর্কিত বিষয়, সেটা টিউরিং সময়কালে তো বটেই, এমনকি বর্তমানেও বুদ্ধিমত্তাকে বৈজ্ঞানিকভাবে সংজ্ঞায়িত করা সম্ভব হয়নি। কিন্তু টিউরিং এর ধারণা ছিল, মানুষের মস্তিষ্কের অভ্যন্তরে ঠিক কি ঘটছে, তা মানুষ না জানলেও যন্ত্রের মাধ্যমে বুদ্ধিদীপ্ত কাজ করানো সম্ভব। তার এই ধারণার উপর ভিত্তি করেই ১৯৫০ সালের দিকে গড়ে উঠেছে কৃত্রিম বুদ্ধিমত্তা|
তিনি বুদ্ধিমত্তার সংজ্ঞা নিরূপনের ঝামেলায় না গিয়ে তিনি যন্ত্রের বুদ্ধিমত্তার অস্তিত্ব প্রমাণে সচেষ্ট হয়েছিলেন বিখ্যাত টিউরিং টেস্টের মাধ্যমে। এটি এমন একটি পরীক্ষা যাতে যন্ত্রঘটিত কাজ মানুষকে বিভ্রান্ত করে দেয়, কাজটি যন্ত্র করেছে নাকি মানুষ করেছে? এক্ষেত্রে একজন মানুষকে নিয়োজিত করা হয় কাজটির বিচারক হিসেবে, তাকে বলতে হবে, কাজটি কে করেছে। মানুষের বিবেচনায় যদি মনে হয় কাজটি যন্ত্র দ্বারা সম্পাদিত হয়েছে, তার অর্থ হল, যন্ত্রটির মানুষের অনুরূপ কাজ করার ক্ষমতা নেই, আর যন্ত্রের কাজ যদি মানুষকে এই অনুভূতি দেয়, যে কাজটি মানব দ্বারা সঙ্ঘটিত হলেও হতে পারে, সেক্ষেত্রে যন্ত্রটিকে মানুষের অনুরূপ বুদ্ধিমত্তার অধিকারী হিসেবে বিবেচনা করা যেতে। বর্তমান কালে যারা কম্পিউটার ব্যবহার করেছেন, তাদের মধ্যে অনেকে ELIZA প্রোগ্রামটির সাথে পরিচিত, যাতে কোন প্রশ্ন করলে, প্রোগ্রামটি আমাদের দৈনন্দিন কথোপকথনের মত পালটা প্রশ্ন করে বসে। আর্টিফিসিয়াল ইন্টিলিজেন্সি শব্দটির সম্ভব্য বাঙ্গলা হয় কৃত্রিম বুদ্ধিমত্তা কিন্তু তাতে নাম করনটি সার্থক হয় না | কৃত্রিম বুদ্ধিমত্তা শব্দটির মানে দাড়ায় “আসল নয় এমন বুদ্ধিমত্তা”| কিন্তু তার চেয়ে বানানো বুদ্ধিমত্তা শব্দটি অনেক বেশী গ্রহনযোগ্য। কিন্তু শব্দটা যতটা মানান সই শুনতে ততটা শ্রুতি মধুর নয়।
জনক ব্রিটিশ গনিতবিদ অ্যালান টিউরিংও বুদ্ধিমত্তার সংজ্ঞা কি তা নিরুপণ করতে পারবেন বলে মনে করেননি, বা এ নিয়ে কারোর সাথে বিতর্কেও যেতে চাননি। বুদ্ধিমত্তা কাকে বলে, তা একটি বহুল বিতর্কিত বিষয়, সেটা টিউরিং সময়কালে তো বটেই, এমনকি বর্তমানেও বুদ্ধিমত্তাকে বৈজ্ঞানিকভাবে সংজ্ঞায়িত করা সম্ভব হয়নি। কিন্তু টিউরিং এর ধারণা ছিল, মানুষের মস্তিষ্কের অভ্যন্তরে ঠিক কি ঘটছে, তা মানুষ না জানলেও যন্ত্রের মাধ্যমে বুদ্ধিদীপ্ত কাজ করানো সম্ভব। তার এই ধারণার উপর ভিত্তি করেই ১৯৫০ সালের দিকে গড়ে উঠেছে কৃত্রিম বুদ্ধিমত্তা|
তিনি বুদ্ধিমত্তার সংজ্ঞা নিরূপনের ঝামেলায় না গিয়ে তিনি যন্ত্রের বুদ্ধিমত্তার অস্তিত্ব প্রমাণে সচেষ্ট হয়েছিলেন বিখ্যাত টিউরিং টেস্টের মাধ্যমে। এটি এমন একটি পরীক্ষা যাতে যন্ত্রঘটিত কাজ মানুষকে বিভ্রান্ত করে দেয়, কাজটি যন্ত্র করেছে নাকি মানুষ করেছে? এক্ষেত্রে একজন মানুষকে নিয়োজিত করা হয় কাজটির বিচারক হিসেবে, তাকে বলতে হবে, কাজটি কে করেছে। মানুষের বিবেচনায় যদি মনে হয় কাজটি যন্ত্র দ্বারা সম্পাদিত হয়েছে, তার অর্থ হল, যন্ত্রটির মানুষের অনুরূপ কাজ করার ক্ষমতা নেই, আর যন্ত্রের কাজ যদি মানুষকে এই অনুভূতি দেয়, যে কাজটি মানব দ্বারা সঙ্ঘটিত হলেও হতে পারে, সেক্ষেত্রে যন্ত্রটিকে মানুষের অনুরূপ বুদ্ধিমত্তার অধিকারী হিসেবে বিবেচনা করা যেতে। বর্তমান কালে যারা কম্পিউটার ব্যবহার করেছেন, তাদের মধ্যে অনেকে ELIZA প্রোগ্রামটির সাথে পরিচিত, যাতে কোন প্রশ্ন করলে, প্রোগ্রামটি আমাদের দৈনন্দিন কথোপকথনের মত পালটা প্রশ্ন করে বসে। আর্টিফিসিয়াল ইন্টিলিজেন্সি শব্দটির সম্ভব্য বাঙ্গলা হয় কৃত্রিম বুদ্ধিমত্তা কিন্তু তাতে নাম করনটি সার্থক হয় না | কৃত্রিম বুদ্ধিমত্তা শব্দটির মানে দাড়ায় “আসল নয় এমন বুদ্ধিমত্তা”| কিন্তু তার চেয়ে বানানো বুদ্ধিমত্তা শব্দটি অনেক বেশী গ্রহনযোগ্য। কিন্তু শব্দটা যতটা মানান সই শুনতে ততটা শ্রুতি মধুর নয়।
ক্রায়োসার্জারি (Cryosurgery)
ক্রায়ো শব্দের অর্থ বরফশীতল। প্রায় শত বছর আগে থেকেই ত্বকের বিভিন্ন ক্ষতের চিকিrসায় এই পদ্ধতি প্রয়োগ করা হচ্ছে। ত্বকের ক্ষেত্রে খুবই কার্যকর হওয়ায় বর্তমানেও ত্বকের বিভিন্ন অসুস্থতা যেমন—তিল, আঁচিল, এ্যাকনি, মেছতা, বিভিন্ন ধরনের টিউমার ও ক্যানসার চিকিrসায় এই পদ্ধতি ব্যবহার করা হয়। এ ছাড়া পাইলস, মুখের ক্যানসার, প্রোস্টেট, যকৃত্ এবং কোনো কোনো হাড়ের ক্যানসার, রেটিনোব্লাসটোমা, জরায়ুর মুখের ক্যানসারসহ বিভিন্ন অঙ্গের চিকিrসায় I এই পদ্ধতি ব্যবহার করা হচ্ছে।
ক্রায়োপ্রোব পৌঁছাতে পারে শরীরের এমন সব অঙ্গের চিকিrসায় এই পদ্ধতিতে করা সম্ভব। তবে সাধারণত আঞ্চলিকভাবে সীমাবদ্ধ এবং এক সেন্টিমিটারের চাইতে বড় শক্ত টিউমারের ক্ষেত্রে এই পদ্ধতি বেশি কার্যকর হতে দেখা যায়। বয়স্ক অথবা যেসব রোগীর পক্ষে অপারেশন বা রেডিওথেরাপির ধকল সহ্য করা সম্ভব নয়, তাদের ক্ষেত্রে এবং কোনো কোনো অঙ্গের ক্যানসারের পূর্বাবস্থায় বিদ্যমান কোষকলা ধ্বংসের উদ্দেশ্যে (যেমন জরায়ুর মুখের ক্যানসার) এই থেরাপি প্রয়োগ করা হলেও বিস্তৃত ক্যানসারের চিকিrসায় এই পদ্ধতি তেমন কার্যকর হয় না।
বরফশীতল তাপমাত্রার কোষকলা ধ্বংস করার ক্ষমতাকে ক্রায়োসার্জারি পদ্ধতিতে কাজে লাগানো হয়। এ ক্ষেত্রে অত্যন্ত শীতল তাপমাত্রায় কোষকলার অভ্যন্তরে বলের আকৃতিবিশিষ্ট ছোট ছোট বরফের কৃস্টাল তৈরি হয়ে এগুলোকে ধ্বংস করে ফেলে। তবে অসুস্থ অঙ্গের কোষকলায় রক্ত সরবরাহকারী ধমনিগুলোকে হিমায়িত করে তুলতে পারলে চিকিrসা অধিক কার্যকর হয়ে ওঠে।
বায়োইনফরমেট্রিক্স (Bioinformatics)
জীববিজ্ঞানের সমস্যাগুলো যখন কম্পিউটেশনাল টেকনিক ব্যবহার করে সমাধান করা হয়, তখন সেটাকে বলা হয় বায়োইনফরমেটিকস| ইন্টারনেটে প্রচুর টুল পাওয়া যাবে বায়োইনফরমেটিকসের| তবে একটু গভীরে ঢুকতে গেলে বুঝতে হবে এলগরিদম, শিখতে হবে প্রোগ্রামিং| আর পাইথন তো নাসার বিজ্ঞানীদের ভাষা! সাঁতার শেখার সবচেয়ে ভালো পদ্ধতি হলো পানিতে লাফ দেয়া| আপনি যদি কম্পিউটার কিংবা জীববিজ্ঞান বিষয়ক কোন বিষয়ে আগ্রহী থাকেন, তাহলে বায়োইনফরমেটিকসের রাজ্যে উঁকি মারতে সমস্যা কি?
একজন নিউরোসায়েন্টিস্টের কথা শোনা যাক: Learn how to do your own data analysis. Know statistics well. Know at least some basic programming/scripting in Python, R, Matlab, etc. This will be of immense value in helping you get your research done efficiently and correctly, without needing to rely on other people’s code (and time and commitment). This will become more important as our field becomes more data driven.
বায়োইনফরমেটিকসের একটা চ্যালেঞ্জ হচ্ছে এটা ইন্টারডিসিপ্লিনারি একটা বিভাগ। তারমানে আপনাকে জানতে হবে:
অবশ্যই জীববিজ্ঞান
এলগরিদম বুঝতে হবে অন্তত
গণিত
ডাটা আছে পরিসংখ্যান থাকবে না!
প্রোগ্রামিং
অপারেটিং সিস্টেম
ATGCACAGTGTCGCGCATATA
ডিএনএ সিকোয়েন্সের একটা ধর্ম হলো এর GC-content| কোন সিকোয়েন্সের মধ্যে কত শতাংশ GC আছে তার উপর নির্ভর করে ওই সিকোয়েন্সটা সম্পর্কে একটা ধারণা লাভ করা যায়। GC-content বের করার সূত্র হলো
GC-content = (G count + C count )/ base count) * 100
তাহলে চলুন প্রোগ্রাম লিখি। আমরা আপাতত পাইথন শেলে কাজ করবো। শেলের সুবিধা হলো এখানে সাথে সাথে কোন কমান্ডের ফলাফল দেখা যায়। তাই কোড টেস্ট করা, শেখার জন্য জিনিসটা ভালো অনেক।
বায়োমেট্রিক্স (Biometrics)
বায়োমেট্রিক্স মানুষের বৈশিষ্ট্য দ্বারা মানুষের পরিচয় উল্লেখ করে| বায়োমেট্রিক্স চিহ্নিতকরণ এবং এর একটি ফর্ম হিসাবে ব্যবহার করা হয় কম্পিউটার বিজ্ঞান প্রবেশাধিকার নিয়ন্ত্রণ| এটি অধীনস্ত যে কোন দলের মধ্যে ব্যক্তি চিহ্নিত করতে ব্যবহার করা হয় নজরদারি|
বায়োমেট্রিক অভিন্ন পরিচয় ব্যক্তি লেবেল এবং বর্ণনা করতে ব্যবহৃত স্বাতন্ত্র্যসূচক, পরিমাপযোগ্য হিসেবে ব্যবহৃত হয়। বায়োমেট্রিক অভিন্ন পরিচয় প্রায়ই শারীরিক বনাম আচরণগত বৈশিষ্ট্য হিসেবে শ্রেণীকরণ করা হয়। একটি শারীরবৃত্তীয় বায়োমেট্রিক Iris স্ক্যান, DNA বা ফিঙ্গারপ্রিন্ট দ্বারা সনাক্ত করা হবে। ব্যবহারিক বায়োমেট্রিক্স এর সাথে সম্পর্কিত করা হয় সহ একজন ব্যক্তি, আচরণ কিন্তু সীমাবদ্ধ রাখে না: টাইপ তাল, চলাফেরার ভঙ্গি, এবং ভয়েস।কিছু গবেষক বায়োমেট্রিক্স এর আধুনিক বর্গ শব্দটি behaviometrics উদ্ভাবন করেছেন|
প্রবেশাধিকার নিয়ন্ত্রণ অধিক প্রথাগত উপায়ে যেমন একটি হিসাবে টোকেন ভিত্তিক সনাক্তকরণ সিস্টেম, অন্তর্ভুক্ত ড্রাইভারের লাইসেন্স যেমন একটি অথবা পাসপোর্ট, এবং জ্ঞান ভিত্তিক সনাক্তকরণ সিস্টেম, পাসওয়ার্ড বা ব্যক্তিগত পরিচিতি সংখ্যা | বায়োমেট্রিক অভিন্ন পরিচয় ব্যক্তিকে অনন্য যেহেতু তারা টোকেনটি ও পদ্ধতি জ্ঞান ভিত্তিক আর পরিচয় যাচাই করার মধ্যে অধিক নির্ভরযোগ্য, যাইহোক, বায়োমেট্রিক অভিন্ন পরিচয় সংগ্রহের এই তথ্য চরম ব্যবহার সম্পর্কে গোপনীয়তা উদ্বেগ উত্থাপন|
জেনেটিক ইঞ্জিনিয়ারিং (Genetic Engineering)
বিজ্ঞান চর্চার প্রাথমিক যুগের সূচনাঘটেছিল গণিত চর্চার মধ্য দিয়ে। মধ্যযুগে তা পদার্থবিদ্যার বিকাশে যুগান্তকারী ভূমিকা রাখে। ধীরে ধীরে নিউটন, গ্যালিলিও, আইনস্টাইন, বোরের তত্ত্ব একে আধুনিক যুগে নিয়ে আসে। কিন্তু, 1920 এর আবিষ্কারের ধারা কিছুটা স্তিমিত হয়ে পড়ে। তখন, বিজ্ঞানীরা ঝুকতে থাকে পরিবেশ, পৃথিবী, মানুষ, জীবজগৎ নিয়ে গবেষণার দিকে। বর্তমানে একবিংশ শতাব্দীকে তাইনিঃসন্দেহে বলা হচ্ছে The Century of Biological Science. এর কারণ 1972 সালে পল বার্গের রিকম্বিনেন্ট ডিএনএ টেকনোলজি বা জেনেটিক ইঞ্জিনিয়ারিং এরআবিষ্কার।
প্রাণ রসায়ণের সবচেয়ে আধুনিক এ শাখায় জীবনকে সংজ্ঞায়িত করা হয় অণু-পরমাণু পর্যায়ে, একে বলা হয় “The Molecular Logic Of Life”। A-T-C-G এই মাত্র চারটি হরফে লেখা এ বিষয়কে বলা হয় Language of GOD. জেনেটিক ইঞ্জিনিয়ারিং মূলত ট্রান্সজেনিক (উন্নত বৈশিষ্টধারী) উদ্ভিদ ও প্রাণী সৃষ্টিতে কাজ করে। নামের শেষে ইঞ্জিনিয়ারিং যোগ করার কারণ হচ্ছে, জীববিজ্ঞানের কেবলমাত্র এ শাখাটিতেই নিজের ইচ্ছামত ডিজাইন করে একটি প্রাণী সৃষ্টি করা যায়, ডিজাইন করা যায় নিজের পছন্দের ই.কোলাই যে কিনা নিজের কথামত উঠবে বসবে। কাজটা অনেকটা একটা কম্পউটার প্রোগ্রাম ডিজাইন করারমত, যা তোমার আদেশ সম্পূর্ণ মেনে চলে। চিন্তা করে দেখ, ব্যাপারটা একজন আবিষ্কারকের জন্য কতটা রোমাঞ্চকর যখনসম্পূর্ণ জীবন্ত কিছু একটা নিজের ডিজাইন মত কাজ করছে?
.
সমাজ জীবনে তথ্য ও প্রযুক্তির প্রভাব
আমরা অনেক শুনেছি প্রতিবাদ, আন্দোলনে ইন্টারনেট এর প্রভাব নিয়ে। আমরা শুনেছি তথ্য বিপ্লবের কথা এবং তা কিভাবে চীন, রাশিয়া, সোভিয়েত ইউনিয়নের কিংবা ইরানের মত দেশ গুলোতে ছড়িয়ে পড়ে।
ধরে নেয়া হতো আসলে ইন্টারনেট খুবই চকৎকার একটি প্রযুক্তি যখন এটি ব্যবহার হয় গনতন্ত্র প্রচারে। তখনি আসেন Cyber utopianism এর ভাবধারায় বিশ্বাসী লোকজন। Cyber utopianism হলো তারা যারা সচেতন ইন্টারনেট স্বাধীনতার অন্ধকার দিক টা নিয়ে সচেতন। তারা বিশ্বাস করত ইন্টারনেট এর দ্রুত তথ্য প্রবাহ সমাজকে পরিবর্তন করবে এবং তা ভাল হবে। তাদের এই একজন গর্ডন ব্রাউন বলেন- এতে তথ্য প্রবাহ হবে দ্রুত এবং মানুষের কাছে যাবে। এবং জনগন নিজস্ব মতামত তৈরি করবে। ধারণা করা হয় ব্লগ বা সামাজিক ওয়েবসাইট গুলো আগেকার দিনে ফ্যাক্স এর দ্রুততম মাধ্যম হিসেবে কাজ করবে।
কাজ প্রযুক্তির এই যুগে মানুষ যেমন তার জীবনযাত্রায় অভাবনীয় পরিবর্তন আনতে সক্ষম হয়েছে তেমন এর অপব্যবহারের ফলও কিন্তু কম নয়। এমন একটি নমুনা হল অনলাইনে প্রতারণা ও এর মাধ্যমে হয়রানির শিকার। সামাজিক যোগাযোগের মাধ্যম ফেসবুক এখন প্রায় সকলের কাছে জনপ্রিয়। ফেসবুকের মাধ্যমে উঠতি বয়সের কিশোর-তরুণরা নানা অপরাধেও জড়িয়ে যাচ্ছে। অধিকাংশ ক্ষেত্রে নারীরাই এর শিকার হচ্ছে। ভাবছেন এর কি কোন প্রতিকার নেই। হ্যাঁ আছে।
তথ্য ও প্রযুক্তি আইন, ২০০৬ এর ৫৭ (১) ধারাতে বলা হয়েছে যদি কোনো ব্যক্তি ইচ্ছাকৃতভাবে ওয়েবসাইটে বা অন্য কোন ইলেক্ট্রনিক বিন্যাসে এমন কিছু প্রকাশ বা সম্প্রচার করে যা মিথ্যা ও অশ্লীল যার দ্বারা কারো মানহানি ঘটে বা ভাবমূর্তি ক্ষুন্ন হয় আর এ ধরনের তথ্যগুলোর মাধ্যমে সংশ্লিষ্ট ব্যক্তির বিরুদ্ধে উসকানি প্রদান করা হলে অনধিক ১০ বছর কারদন্ড এবং অনধিক এক কোটি টাকা অর্থদণ্ডে দণ্ডিত হওয়ার বিধান আছে।
আবার পর্নোগ্রাফি আইন ২০১২ এ আছে, কোন ব্যক্তি ইন্টারনেট বা ওয়েবসাইট বা মোবাইল ফোন বা অন্য কোন ইলেকট্রনিক ডিভাইসের মাধ্যমে পর্নোগ্রাফি সরবরাহ করলে তিনি এ ধরণের অপরাধের জন্য সর্বোচ্চ ৫ (পাঁচ) বৎসর পর্যন্ত সশ্রম কারাদণ্ড এবং ২০০০০০ (দুই লক্ষ) টাকা পর্যন্ত অর্থদণ্ডে দণ্ডিত হবেন।
আবার অনেকে এইসব আইন সম্পের্কে জানিনা বা জেনেও আইনের আশ্রয় নেই না বলে এসব অপরাধ ও অপরাধীকে দমানো কঠিন হচ্ছে।
বর্তমানে আমাদের দৈনন্দিন জীবন ওতোপ্রতোভাবে জড়িত মিডিয়া ও প্রযুক্তির সঙ্গে, আর সেই মাধ্যমগুলো হচ্ছে সংবাদপত্র, টেলিভিশন, রেডিও, মোবাইল, কম্পিউটার-ল্যাপ্টপ, ইন্টারনেট সহ আরো উন্নত প্রযুক্তি।
বিশ্ব এখন আমাদের হাতের মুঠোয়। মুর্হুতের মধ্যেই ছড়িয়ে পড়ছে বিশ্বের যেকোন প্রান্তের যেকোন খবর। ইন্টারনেট হলো এমন একটি মাধ্যম যার সাহায্যে জানা জাচ্ছে যে কোন দেশের রাজনীতি, অর্থনীতি, ইতিহাস, দর্শন, ভৌগলিক অবস্থান, সংস্কৃতি, আর্থ-সামাজিক অবস্থান, দৈনন্দিন চলমান সংবাদ সম্পর্কে সম্যক ধারনা।
বাংলাদেশের প্রেক্ষাপটে মিডিয়া ও প্রযুক্তির মূল ব্যবহারকারী হচ্ছে এদেশের তরুন সমাজ। এটা অবশ্যই অনেক ভাল দিক যে, আমাদের দেশের তরুন-তরুনীরা বিশ্বের সাথে তাল মিলাচ্ছে। কিন্তু কথা হচ্ছে মিডিয়া ও প্রযুক্তির ব্যবহারে আমাদের তরুন-তরুনীরা কতটুকু সচেতন?
বিশ্বব্যাপি ইন্টারনেবট এর ব্যবহার প্রাচ্য দেশ গুলোতে ছড়িয়ে দেয়ার যৌক্তিকতা কিছুটা আর্থিক এবং সাময়িক ! ইন্টারনেট বিপলবের শুরুর দিকে প্রচার করা হয় এতে সবাই “connected” থাকবে ! বলা হত এতে গনতন্ত্র হবে অনিবার্য ! কিন্তু তার পেছনে অন্য রাজনৈতিক চাল ও ছিল ও বটে!কি রকম, দেখা যাক আমেরিকানরা এজন্য দ্রুত চীন, রাশিয়, ইরান এর মত দেশ গুঃেলাকে টেকনোলজি ব্যবহার করতে দেয় এই বলে এতে গনতন্ত্র সুসম্মত হবে! তারপর আসল্যে আইপড এর উদারতা ! প্রাচ্যর রাজনৈতিক নীতি নির্ধারকরা বিশ্বাস করত যদি কারো কাছে আইপড, ল্যাপটপ এর মত জিনিস থাকবে তারা ধীরে ধীরে প্রাচ্য ভার ধারায় বিশ্বাসী হয়ে উঠবে। আমেরিকান লেখক , কলামিষ্ট থমাস ফ্রাইডমেন বলেন , “রাশিয়া, চীন, ইরানের মত দেশ গুলো দখল করার জন্য বোমা নয় আইপড ফেলো !!”
তথ্য ও যোগাযোগ প্রযুক্তি ও অর্থনৈতিক উন্নয়ন
প্রযুক্তি মানুষকে পরিবর্তিত বিশ্বের চ্যালেঞ্জ মোকাবেলায় তথ্য-জ্ঞান-দক্ষতা-কৌশল-প্রবণতা এবং যন্ত্রপাতি সমৃদ্ধ করে তোলে কার্ল মার্কসের ভাষায়- ‘‘প্রযুক্তি হচ্ছে মানুষের প্রতিদিনের সাথী’’ মানুষ এই প্রযুক্তির সাথে প্রতিদিন অব্যাহতবাবে গায়ে গায়ে লেগে আছে। এ লেগে থাকা হয় জ্ঞান-দক্ষতা- বা শারীরিক আকারে চলতে পারা। সোজা সরল ও সংক্ষেপে বলা যায়-, প্রযুক্তি মানুষকে যোগায় জীবন সহায়ক ব্যবস্থা বা লাইফ সার্পোট সিস্টেম, যে কারনে মানুষ পৃথিবীতে নিজেকে খাপ খাইয়ে নেয়ার শক্তি অর্জন করে।
তথ্য প্রযুক্তির কল্যাণে মানুষের জীবন হয়েছে এখন অনেক সহজ, সরল এবং স্বাচ্ছন্দ্যময়। ঘরে বসে বিশ্ব ভ্রমণ, মার্কেটিং, ব্যাংকিং বিভিন্ন ধরনের সার্ভিস কিম্বা র্ভাচুয়াল ওয়ার্ল্ডে ঘোরা ঘুরি করা এখন একেবারে সহজ। তাইতো এখন মানুষের এমন কোন কাজ নেই যেখানে প্রযুক্তির ছোয়া লাগেনি।
একুশ শতকের চ্যালেঞ্জ মোকাবিলায় তথ্য ও যোগাযোগ প্রযুক্তি পৃথিবীর দরিদ্র জনগোষ্টির জন্য খুলে দিয়েছে অপার সম্ভাবনার দুয়ার। ইতহিাসের ধারাবাহিকতায় কৃষি বিপ্লব, শিল্প বিপ্লবের পর বর্তমান পৃথিবী নতুনতর এক বিপ্লবের মুখোমুখি হতে চলেছে যার নাম তথ্য বিপ্লব। একথা বলার অপেক্ষা রাখে না যদি এই শতাব্দীকে নতুন কোন নামে অভিহিত করা হয় তবে তথ্য প্রযুক্তির শতাব্দী হবে তার জন্য উপযুক্ত।
বর্তমান শতাব্দীর গ্লোবালাইজেশনের ফলে একটি দেশের উন্নয়ন এবং দারিদ্র্য বিমোচনের ক্ষেত্রে তথ্য এবং যোগাযোগ প্রযুক্তি অন্যতম নিয়ামকের ভূমিকা পালন করছে। তথ্য ও যোগাযোগ প্রযুক্তির হাতিয়ার হচ্ছে কম্পিউটার এবং ইন্টারনেট। কম্পিউটার এবং ইন্টারনেটের বদৗলতে পৃথিবী এখন গ্লোবাল ভিলেজে পরিণত হয়েছে। বলা চলে পৃথিবী হাতের মুঠোয় নয় আঙুলের ডগায় চলে এসেছে। কম্পিউটার প্রযক্তির ব্যাপক ব্যবহার এবং সফল প্রয়োগ যে কোন অনুন্নত দেশকে উন্নত করতে অগ্রণী ভূমিকা পালনে সচেষ্ট।
কম্পিউটার এমন এক ধরনের প্রযুক্তি যার মাধ্যমে শিক্ষা, চিকিৎসা, বিনোদন, অর্থনীতি, রাজনীতি, বিনিয়োগ, ব্যবসা-বাণিজ্য, পরিকল্পনা, গবেষণা, নিয়ন্ত্রণ, ডিজাইন ইত্যাদি বিষয়াবলীকে একটি প্রক্রিয়ার মাধ্যমে সংযুক্ত করা সম্ভব। আর এই তথ্য প্রবাহ একটি সম্বন্বিত সূত্রে গ্রথিত হয়ে পৃথিবীর সকজ জাতি, ধর্ম, বর্ণ-গোষ্ঠীর মানুষকে সম্বন্বিত তথ্য প্রবাহের সঙ্গে অবিরাম সংযুক্ত রাখতে সচেষ্ঠ। আমরা দেখেছি বিংশ শতাব্দীতে তথ্যের আদান প্রদান হয়েছে টেলিগ্রাফ, টেলিফোন, টেলিফ্যাক্স, টেলেক্স, পোষ্টাল, কুরিয়ার সার্ভিস ইত্যাদির মধ্যে দিয়ে, কিন্তু বর্তমানে বিশ্বব্যাপী যোগাযোগ ব্যবস্থার অভুতপূর্ব অগ্রগতি সাধিত হওয়ায় এখন আর এই সমস্ত মাধ্যম নতুন কিছু নয়। এখন প্রেরক প্রতিঠি ক্ষেত্রেই কত দ্রুত সুষ্ঠুভাবে প্রয়োজনীয় বার্তা প্রাপকের কাছে পৌঁছাতে পারবে এই ভাবনায় এখন উদ্ভাবকের বহুবিধ উদ্ভাবনের ভিত্তি হিসাবে কাজ করছে।
কম্পিউটার এবং স্যাটেলাইট প্রযুক্তিকে কাজে লাগিয়ে তথ্য আদান-প্রদানের ক্ষেত্রে যে পদ্ধতিটি অভূতপূর্ব, যুগান্তকারী, অকল্পনীয় ও অবিশ্বাস্য বিপ্লব সাধিত করেছে তার নাম ইন্টারনেট। আজকে বিশ্বের সমস্ত উন্নত এবং উন্নয়নশীল দেশ ইনফরমেশন সুপার হাইওয়ে বা তথ্যের মহাসড়কে প্রবেশ করে চলেছে। কম্পিউটার ভিত্তিক তথ্য বিনিময়ের অপূর্ব এই ব্যবস্থা গড়ে তুলেছে বিশ্বের তথ্য অবকাঠামো বা গ্লোবাল ইনফরমেশন ইনফ্রাষ্ট্রোকচার বা সংক্ষেপে জিআইআই। পৃথিবীর প্রায় সব ধরনের তথ্য ব্যবস্থা এই জিআইআই এর অর্ন্তভূক্ত হচ্ছে; তথ্যের এই মহা রাজপথে যার অবস্থান যত দূঢ় ঠিক সেই অনুপাতে তথ্য আর জ্ঞানের ভান্ডার চলে যাবে তার নিয়ন্ত্রণে, যা ছাড়া ভবিষ্যতে টিকে থাক যেন এক দু:সাধ্য ব্যাপার।
তথ্যই শক্তি
পৃথিবীতে বেঁচে থাকার স্বার্থে তথ্যের প্রয়োজন যার নিকট যত বেশী তথ্য রয়েছে সে তত বেশী শক্তিশালী। পরিবেশ, খাদ্য, জীবন-ব্যবস্থা, প্রতিবেশী, আবহাওয়া, কর্ম, সুযোগ, শিক্ষা, গবেষণা, প্রতিযোগি ইত্যাদি সম্পর্কে আমাদের তথ্য একান্ত পয়োজন যদি আমাদের কাছে তথ্য আসা বন্ধ হয়ে যায় তবে হয়তো আমাদের বেঁচে থাকা সম্ভব হবে না। বেঁচে থাকার তাগিদে প্রযুক্তি যে তথ্য সংগ্রহে সাহায্য করে তা নিসন্দেহে মূল্যবান, কারণ এক সময়ে বলা হতো ‘জ্ঞানই শক্তি’ কিন্ত বর্তমানে বলা হয় ‘তথ্যই শক্তি’। সম্প্রতি বাংলাদেশের উপকুলের উপর দিয়ে বয়ে যাওয়া প্রলয়ংকারী ঘূণিঝড় ‘সিডর’ এর আঘাতে লন্ড ভন্ড হয়ে গেছে সমগ্র উপকুল কিন্তু ৯১ এর জলোচ্ছাসের চেয়ে প্রাণহানি ঘটেছে তুলনামূলক কম এর একটি মাত্র কারণ আর তা হলো যথা সময়ে জনগনের নিকট পর্যাপ্ত তথ্য প্রবাহ। সভ্যতার বিনাশে বা সভ্যতার বিকাশের ক্ষেত্রে তথ্য একজটি গুরুত্বপূর্ণ ভূমিকা রাখে আর সেই কারনেই তথ্য আমাদের সকলের প্রয়োজন, প্রয়োজন তথ্যের মহাসড়কে প্রবেশ করা। আর তথ্যের মহাসড়কে ইন্টারনেট একত্রিত করে চলেছে- টেলিফোন, কনফারেন্সিং, সরাসরি বিপিনণ, শিক্ষা, গবেষণা, অফিস ব্যবস্থাপনা, টিভি সম্প্রচার, প্রতিরক্ষা ইত্যাদিকে, যার মাধ্যমেআপনি আপনার প্রয়োজনীয় তথ্যটি সংগ্রহ করতে পারেন।
অবাধ তথ্য প্রবাহের গুরুত্ব
আর্থ-সামাজিক উন্নয়ন তথা দারিদ্র বিমোচনের ক্ষেত্রে অবাধ তথ্য প্রবাহের গুরুত্ব অপরিসীম। কারণ, যে চীনে কমুইনিষ্ট শাসকরা বছরের পর বছর ধরে পাশ্চাত্যে মন্দ ও খারাপ জিনিস গুলো নিজস্ব সংস্কৃতিতে প্রবেশ করতে পারে এই দোহাই দিয়ে অবাধ তথ্য আদান-প্রদান বন্ধ
প্রদান বন্ধ রেখেছিল তারাই আবার জনগনের অবাধ তথ্য আদান –প্রদান উম্মুক্ত করে দিল এর কারণ তারা সর্বাধুনিক কলা কৌশল এবং বাজারের অবস্থার সঙ্গে তাল মিলিয়ে চলতে চাচ্ছে। বেইজিং ওর্য়াল্ড ব্যাংক অফিসের একজন ইনফরমেশন টেকনোলজি স্পেশালিষ্ট বলেছেন যে, ‘‘ব্যবসায়ীরা জানে যত তাড়াতাড়ি তারা বির্হিবিশ্বের সাথে যোগাযোগ স্থাপন করতো তারাই ইন্টারনেটের মাধ্যমে উম্মক্তকরে দিয়েছে চায়নাকে। আর জাপানের কথাতো বলার অপেক্ষা রাখে না কেননা জাপান আজ রীতিমত পশ্চিম ইউরোপ এবং আমেরিকার মাথা ব্যাথার কারণ হয়ে দাড়িয়েছে। অন্যদিকে এই প্রযুক্তি ব্যবহারে নতুন নতুন শক্তি হিসাবে অর্বিভূত হয়েছে দক্ষিণ কোরিয়া, তাইওয়ান, সিঙ্গাপুর, থাইল্যান্ড, মালয়েশিয়া, ইন্দোনেশিয়া, চীন এবং ভার। এদের পদাংখ অনুসরণ করে শ্রীলংকা, পারিকস্তান, ফিলিপাইন এবং ভিয়েতনাম এগিয়ে চলেছে। শুধু পিছিয়ে রয়েছি আমরা। তথ্য পাচার হওয়ার অজুহাত দেখিয়ে বাংলাদেশকে প্রায় দুই যুগ পিছনে ঠেলে দেয়া হয়েছে তবে আশার কথা বহু চড়াই উত্তরাই পেরিয়ে ২০০৬ ইং সালের ২১ মে বাংলাদেশ সাবমেরিন কেবলের মাধ্যমে ইনফরমেশন সুপার হাইওয়ের সঙ্গে যুক্ত হওয়ার সৌভাগ্য অর্জন করেছে। কিন্তু দুঃখের বিষয় সাবমেরিন ক্যাবলের যথাযথ ব্যবহার নিশ্চিত করা এখন সম্ভবপর হয় নাই।
ই-গর্ভনেস
একটি দেশের সরকার সে দেশের জনগনের জীবন যাত্রার মান উন্নয়ােন সদা সচেষ্ট। কিন্তু জনগনের সাথে সরাসরি ইন্টারএ্যাকশান না তাকার ফলে দ্রুত সিদ্ধান্ত গ্রহণ ও তা বাস্তবায়ন করা সম্ভবপর হয়ে উঠে না। যদি গ্রাম ও শহর অঞ্চলের মধ্যে যোগাযোগ স্থাপন করা যায় তাহলে তা দেশের মানুষের জীবন যাত্রার মান উন্নয়নে সহায়ক হবে। সরকারের কাজের গতি বাড়াবে, আমলাতান্ত্রিক জটিলতা হ্রাস পাবে। অবাধ তথ্য প্রবাহ, স্বচ্ছতা এবং জবাবদিহিতা নিশ্চিত করা সহজ হবে। আর এই কাজটি তখনই সম্ভব হবে যখন ই-গর্ভনেস বা ইলেকট্রনিক সরকার ব্যবস্থা প্রচলিত হবে।
আইসিটির ব্যবহার নিশ্চিত করা সম্ভবহলে আমলাতন্ত্র মুক্ত দক্ষ প্রশাসন ব্যবস্থা চালু করা সম্ভব হবে। কারন কম্পিউটার এবং তথ্য প্রযুক্তিতে দক্ষপ্রশিক্ষিত জনবলের কারনে প্রশাসন হয়ে উঠবে গতিশীল চাওয়া মাত্রই যে কোন তথ্য পাওয়া সম্ভব হবে ফলে লাল ফিতার দৌরত্মা কমে যাবে। অনলাইনে টেন্ডার, নিয়োগ বিজ্ঞপ্তি ইত্যাদি প্রকাশ করার ফলে সন্ত্রাসী কার্যক্রম কমে যাবে। সব কিছু যেহেতু অটোমেশনের মাধ্যমে হতে সেহেতু দূর্নীতি অনেকটা কমে যাবে।
ই-পুলিশিং ব্যবস্থা চালু করা সম্ভব হলে প্রতিটি পুলিশ ষ্টেশনকে একটি সমন্বিত নেটওর্য়াকের আওতায় আনতে পারলে দেশের প্রতিদিনের আইন শৃংখলা মনিটরিং করা সহজ হবে। জিডি ও এজহার এন্ট্রি, মামলা নিম্পত্তির ব্যাপারে কম্পিউটারে রের্কড থাকার ফলে আদালত যে কোন সময় মামলা সংক্রান্ত ত্যথাদি প্রাপ্ত হবেন যার ফলে মামলা গুলোর দ্রুত নিস্পত্তি করা সহজ হবে। অন্যদিকে মামলার ফাইল হারানো ভয় থাকবে না। দেশের শতকরা ৮০ ভাগ মামলায় যেহেতু ভুমি সংক্রান্ত সেহেতু ভুমি প্রশাসনে কম্পিউটারায়নে দূর্নীতি অনেক হ্রাস পাবে। অন্যদিকে নাগরিক সেবা প্রাপ্তি সহজতর হবে। ই-হেলথ বাস্তবায়ন করা সম্ভব হলে দেশের নাগরিক অতি দ্রুত এবং গ্রামের প্রত্যন্ত অঞ্চলে থেকেও বিশেষজ্ঞ ডাক্তারের নিকট থেকে চিকিৎসা সেবা পেতে পারেন। ই-লানিং বাস্তবায়ন করা সম্ভব হলে যে কেউ ঘরে বসেই ডিগ্রী অর্জন করতে পারবে।
ই-কর্মাস ও এম কমার্সের মাধ্যমে শেয়ার বাজার থেকে শুরু করে যে কোন ধরনের নিত্য প্রয়োজনীয় জিনিস পত্রাদী এর মাধ্যমে ক্রয় করা সম্ভব হবে। এক্ষেত্রে ক্রেডিট কার্ড ব্যবহার করা হবে। প্রতারিত ক্রেতা কেউ কনজিউমার রাইটসের আওতায় সাজা দেয়া সম্ভব হবে। অনলাইন ব্যাংকি এর মাধ্যামে ২৪ঘন্টায় নাগরিক সেবা পেতে পারে। এছাড়া সরকারী সব ধরনের কর, বিল, ইউটিলিটি বিল প্রভৃতি পরিশোধের ব্যবস্থা থাকবে। ন্যাশনাল ডাটাবেজ তৈরি করা সম্ভব হলে প্রতিটি নাগরিকের ব্যক্তিগত প্রোফাইল ও মানব উন্নয়ন সূচকসমূহ স্থান পাবে। ফলে এ ডাটাবেজ একই সাথে নাগরিক পরিচয় পত্র সনাক্তকরনের মাধ্যম ও জাতীয় মানব সম্পদ সংক্রান্ত তথ্যের উৎস হিসাবে কাজ করবে। যে কোন নাগরিক অন লাইনে মতামত করতে পারবে।
ICT (Communication system and Networking) লেকচার শিট HSC 1st year 2016
Communication system and Networking
Chapter -2
Data Communication & Computer Network
Definition of communication system: A system that exchange data between persons and equipment’s or device is called communication system. A communication system is made up of device that employee one of two communication method (Wireless or wired), different types of equipment (portable radios, mobile radios, base or fixed station and repeaters) and various accessories (speaker, microphone, battery eliminators) to meet the user needs.
Another definition of communication system: A system that exchange data between persons and equipment or device is called communication system
Data communication system: Data communication system is the function of transporting data from one point another.
Elements of data communication system: A data communication system has five fundamental elements, such as
i)Data source: Source is the computer where available data are obtained to send; examples are telephone and computers.
ii)Transmitter: The transmitter is the device that transmits the source data in the communication medium; example modem.
iii)Medium: The transmission medium is the physical path which a message travels from transmitter to receiver . It could be twisted pair wire, coaxial cable , fiber optic cable or radio waves.
iv)Receiver: It is the modem located at destination side that converts received data into computer readable form or in digital form.
v)Destination: The computer that finally store the incoming message or data is known as destination.
Fig: General Block diagram of Data communication Data transmission Speed
A term used to describe the data-handling capacity of a communications system is bandwidth. Bandwidth is the range of frequencies that is available for the transmission of data. The wider the bandwidth of a communications system, the more data it can transmit in a given period of time. Depending on the transmission speed, communication channels are grouped into three basic components-
A. Narrow Band: Narrow band channels range is speed from 45 to 300 bps. They are used for handling low data volumes and are fit for low-speed devices.
Example- Telegraph and low speed terminals.
B. Voice Band: Voice band channels can transmit data at speeds up to 9600 bps. They are so called because their major application is for ordinary telephone voice communication.
Example: Data transmission from card reader to CPU or from CPU to line printer.
C. Broad Band: Broad band or wide band channels are used when large volumes of data is to be transmitted at high speed. They system provide data transmission rate of 1 million bps or more.
Example: Use Optical fiber for data transmission.
2.3 Methods of data transmission: Data transmission method means how data is being transmitted from source to destination. Data transmission on a line is normally carried out in three different modes
i)Asynchronous Transmission:
ii) Synchronous Transmission:
iii) Isochronous Transmission
i)Asynchronous Transmission: Asynchronous transmission is often referred to as start-stop transmission because of its nature, that is, the sender can send a character at any time convenient and the receiver will accept it
Characteristics of Asynchronous transmission:
1. The sender can transmit the data any time and the receiver can receive the data at any time.
2. There is no necessity of primary storage device in transmission station.
3. Interval between characters may be uneven.
4. Less efficient and low speed.
5. A start bit and a stop bit is to send with each character.
6. The medium remains idle when there is no transmission of data.
Advantage of Asynchronous transmission:
The advantages of Asynchronous transmission is given below-
1. It is suitable for few amount of data transmission.
2. It does not requires any local storage at the terminal.
3. The cost is comparatively less then synchronous transmission
4. The sender can transmit the data any time and the receiver can receive the data at any time.
Disadvantage of Asynchronous transmission:
The disadvantage of Asynchronous transmission is given below-
1.The efficiency and speed is less then synchronous transmission.
2.It is does not use when there is no data transmission.
3. The cost of transmission is increased for microwave or satellite wave if transmission is closed.
4. Large overhead for start and stop bits.
5.Error handling usually more complex.
6. It does not support full-duplex data transmission.
ii) Synchronous Transmission: Synchronous transmission means that the bit stream is combined into longer “frames” which contain multiple bytes. Each byte is introduced onto the transmission link without a gap between it and the next one .Each frame contains 80 and 132 bytes data.
Characteristics of Synchronous Transmission:
1.There are no gaps between character being transmitted.
2.Efficiency is more.
3.Transmission speed is more.
4.Needs primary storage at sender station.
Advantage of Synchronous Transmission:
The advantages of Synchronous transmission is given below-
1.Lower overhead and thus, greater throughput.
2.Higher speeds then Asynchronous.
3.Error handling usually easy.
4.Support full-duplex data transmission.
5.It is suitable for large amount data transmission.
6.It is suitable for long distance data transmission. Disadvantage of Synchronous Transmission:
The disadvantages of Synchronous transmission is given below-
1.Slightly more complex.
2.Hardware is more expensive.
3.Service must be up and early
4.For correct operation the receiver must start to sample the line at the correct instant.
5.It needs a primary storage device in transmitter station.
Fig: Asynchronous and Synchronous transmission method
iii) Isochronous Transmission: An isochronous data transfer systems combines the feature of an asynchronous and synchronous data transfer system. An isochronous data transfer system sends blocks of data asynchronously, in other words the data stream can be transferred at random interval.
Each transmission begins with a start packet. Once the start packet is transmitted, the data must be delivered with a guaranteed bandwidth. Isochronous data transfer is commonly used for where data must be delivered within certain time constraints, like streaming video.
Transmission Modes in Computer Networks Transmission mode means transferring of data between two devices. It is also called communication mode. These modes direct the direction of flow of information. There are three types of transmission mode. They are : Simplex Mode Half duplex Mode Full duplex Mode
SIMPLEX Mode In this type of transmission mode data can be sent only through one direction i.e. communication is unidirectional. We cannot send a message back to the sender. Unidirectional communication is done in Simplex Systems. Examples of simplex Mode is loudspeaker, television broadcasting, television and remote, keyboard and monitor etc.
HALF DUPLEX Mode In half duplex system we can send data in both directions but it is done one at a time that is when the sender is sending the data then at that time we can’t send the sender our message. The data is sent in one direction. Example of half duplex is a walkie- talkie in which message is sent one at a time and messages are sent in both the directions.
FULL DUPLEX Mode In full duplex system we can send data in both directions as it is bidirectional. Data can be sent in both directions simultaneously. We can send as well as we receive the data. Example of Full Duplex is a Telephone Network in which there is communication between two persons by a telephone line, through which both can talk and listen at the same time. In full duplex system there can be two lines one for sending the data and the other for receiving data.
According to selection of path in network routing, data transmission mode can be divided into many ways:
Unicast
Broadcast
Multicast
Anycast
Geocast
Medium Of Data Communication
There are two categories of transmission media
Bounded/ Guided media
Unbounded/ Unguided
Bounded/Guided Transmission Media It is the transmission media in which signals are confined to a specific path using wire or cable. The types of Bounded/ Guided are discussed below.
Twisted Pair Cable This cable is the most commonly used and is cheaper than others. It is lightweight, cheap, can be installed easily, and they support many different types of network. Some important points : Its frequency range is 0 to 3.5 kHz. Typical attenuation is 0.2 dB/Km @ 1kHz. Typical delay is 50 μs/km. Repeater spacing is 2km. Twisted Pair is of two types : Unshielded Twisted Pair (UTP) Shielded Twisted Pair (STP)
Unshielded Twisted Pair Cable It is the most common type of telecommunication when compared with Shielded Twisted Pair Cable which consists of two conductors usually copper, each with its own color plastic insulator. Identification is the reason behind colored plastic insulation. UTP cables consist of 2 or 4 pairs of twisted cable. Cable with 2 pair use RJ-11 connector and 4 pair cable useRJ-45 connector. Advantages : Installation is easy Flexible Cheap It has high speed capacity, 100 meter limit Higher grades of UTP are used in LAN technologies like Ethernet. It consists of two insulating copper wires (1mm thick). The wires are twisted together in a helical form to reduce electrical interference from similar pair. Disadvantages : Bandwidth is low when compared with Coaxial Cable Provides less protection from interference.
Shielded Twisted Pair Cable This cable has a metal foil or braided-mesh covering which encases each pair of insulated conductors. Electromagnetic noise penetration is prevented by metal casing. Shielding also eliminates crosstalk (explained in KEY TERMS Chapter). It has same attenuation as unshielded twisted pair. It is faster the unshielded and coaxial cable. It is more expensive than coaxial and unshielded twisted pair. Advantages : Easy to install Performance is adequate Can be used for Analog or Digital transmission Increases the signalling rate Higher capacity than unshielded twisted pair Eliminates crosstalk Disadvantages : Difficult to manufacture Heavy
Coaxial Cable Coaxial is called by this name because it contains two conductors that are parallel to each other. Copper is used in this as centre conductor which can be a solid wire or a standard one. It is surrounded by PVC installation, a sheath which is encased in an outer conductor of metal foil, barid or both. Outer metallic wrapping is used as a shield against noise and as the second conductor which completes the circuit. The outer conductor is also encased in an insulating sheath. The outermost part is the plastic cover which protects the whole cable.
Advantages : Bandwidth is high Used in long distance telephone lines. Transmits digital signals at a very high rate of 10Mbps. Much higher noise immunity Data transmission without distortion.
The can span to longer distance at higher speeds as they have better shielding when compared to twisted pair cable Disadvantages : Single cable failure can fail the entire network. Difficult to install and expensive when compared with twisted pair. If the shield is imperfect, it can lead to grounded loop.
Fiber Optic Cable These are similar to coaxial cable. It uses electric signals to transmit data. At the centre is the glass core through which light propagates. In multimode fibres, the core is 50microns, and In single mode fibres, the thickness is 8 to 10 microns. The core in fiber optic cable is surrounded by glass cladding with lower index of refraction as compared to core to keep all the light in core. This is covered with a thin plastic jacket to protect the cladding. The fibers are grouped together in bundles protected by an outer shield. Fiber optic cable has bandwidth more than 2 gbps (Gigabytes per Second) Advantages :
Provides high quality transmission of signals at very high speed. These are not affected by electromagnetic interference, so noise and distortion is very less. Used for both analog and digital signals. Disadvantages : It is expensive Difficult to install. Maintenance is expensive and difficult. Do not allow complete routing of light signals. UnBounded/UnGuided Transmission Media Unguided or wireless media sends the data through air (or water), which is available to anyone who has a device capable of receiving them. Types of unguided/ unbounded media are discussed below : Radio Transmission MicroWave Transmission
Radio Transmission Its frequency is between 10 kHz to 1GHz. It is simple to install and has high attenuation. These waves are used for multicast communications. Types of Propogation Radio Transmission utilizes different types of propogation : Troposphere : The lowest portion of earth’s atmosphere extending outward approximately 30 miles from the earth’s surface. Clouds, jet planes, wind is found here.
Ionosphere : The layer of the atmosphere above troposphere, but below space. Contains electrically charged particles.
Microwave Transmission It travels at high frequency than the radio waves. It requires the sender to be inside of the receiver. It operates in a system with a low gigahertz range. It is mostly used for unicast communication. There are 2 types of Microwave Transmission : 1. Terrestrial Microwave 2. Satellite Microwave Advantages of Microwave Transmission Used for long distance telephone communication Carries 1000’s of voice channels at the same time Disadvantages of Microwave Transmission It is Very costly
Terrestrial Microwave For increasing the distance served by terrestrial microwave, repeaters can be installed with each antenna .The signal received by an antenna can be converted into transmittable form and relayed to next antenna as shown in below figure. It is an example of telephone systems all over the world
Satellite Microwave This is a microwave relay station which is placed in outer space. The satellites are launched either by rockets or space shuttles carry them. These are positioned 3600KM above the equator with an orbit speed that exactly matches the rotation speed of the earth. As the satellite is positioned in a geo-synchronous orbit, it is stationery relative to earth and always stays over the same point on the ground. This is usually done to allow ground stations to aim antenna at a fixed point in the sky. Features of Satellite Microwave :
Bandwidth capacity depends on the frequency used. Satellite microwave deployment for orbiting satellite is difficult. Advantages of Satellite Microwave : Transmitting station can receive back its own transmission and check whether the satellite has transmitted information correctly. A single microwave relay station which is visible from any point. Disadvantages of Satellite Microwave : Satellite manufacturing cost is very high Cost of launching satellite is very expensive Transmission highly depends on whether conditions, it can go down in bad weather Types of Communication Networks
Local Area Network (LAN) It is also called LAN and designed for small physical areas such as an office, group of buildings or a factory. LANs are used widely as it is easy to design and to troubleshoot.
Personal computers and workstations are connected to each other through LANs. We can use different types of topologies through LAN, these are Star, Ring, Bus, Tree etc. LAN can be a simple network like connecting two computers, to share files and network among each other while it can also be as complex as interconnecting an entire building. LAN networks are also widely used to share resources like printers, shared hard-drive etc. Applications of LAN One of the computer in a network can become a server serving all the remaining computers called clients. Software can be stored on the server and it can be used by the remaining clients. Connecting Locally all the workstations in a building to let them communicate with each other locally without any internet access. Sharing common resources like printers etc are some common applications of LAN.
Metropolitan Area Network (MAN) It is basically a bigger version of LAN. It is also called MAN and uses the similar technology as LAN. It is designed to extend over the entire city. It can be means to
connecting a number of LANs into a larger network or it can be a single cable. It is mainly hold and operated by single private company or a public company.
Wide Area Network (WAN) It is also called WAN. WAN can be private or it can be public leased network. It is used for the network that covers large distance such as cover states of a country. It is not easy to design and maintain. Communication medium used by WAN are PSTN or Satellite links. WAN operates on low data rates.
Wireless Network It is the fastest growing segment of computer. They are becoming very important in our daily life because wind connections are not possible in cars or aeroplane. We can access Internet at any place avoiding wire related troubles.. These can be used also when the telephone systems gets destroyed due to some calamity/disaster. WANs are really important now-a-days.
Types of Network Topology
Network Topology is the schematic description of a network arrangement, connecting various nodes(sender and receiver) through lines of connection.
BUS Topology
Bus topology is a network type in which every computer and network device is connected to single cable. When it has exactly two endpoints, then it is called Linear Bus topology.
Features of Bus Topology
1. It transmits data only in one direction.
2. Every device is connected to a single cable Advantages of Bus Topology
1. It is cost effective.
2. Cable required is least compared to other network topology.
3. Used in small networks.
4. It is easy to understand.
5. Easy to expand joining two cables together. Disadvantages of Bus Topology
1. Cables fails then whole network fails.
2. If network traffic is heavy or nodes are more the performance of the network decreases.
3. Cable has a limited length.
4. It is slower than the ring topology.
RING Topology
It is called ring topology because it forms a ring as each computer is connected to another computer, with the last one connected to the first. Exactly two neighbours for each device.
Features of Ring Topology
1. A number of repeaters are used for Ring topology with large number of nodes, because if someone wants to send some data to the last node in the ring topology with 100 nodes, then the data will have to pass through 99 nodes to reach the 100th node. Hence to prevent data loss repeaters are used in the network.
2. The transmission is unidirectional, but it can be made bidirectional by having 2 connections between each Network Node, it is called Dual Ring Topology.
3. In Dual Ring Topology, two ring networks are formed, and data flow is in opposite direction in them. Also, if one ring fails, the second ring can act as a backup, to keep the network up.
4. Data is transferred in a sequential manner that is bit by bit. Data transmitted, has to pass through each node of the network, till the destination node. Advantages of Ring Topology
1. Transmitting network is not affected by high traffic or by adding more nodes, as only the nodes having tokens can transmit data.
2. Cheap to install and expand Disadvantages of Ring Topology
1. Troubleshooting is difficult in ring topology.
2. Adding or deleting the computers disturbs the network activity.
3. Failure of one computer disturbs the whole network.
STAR Topology
In this type of topology all the computers are connected to a single hub through a cable. This hub is the central node and all others nodes are connected to the central node.
Features of Star Topology
1. Every node has its own dedicated connection to the hub.
2. Hub acts as a repeater for data flow.
3. Can be used with twisted pair, Optical Fiber or coaxial cable. Advantages of Star Topology
1. Fast performance with few nodes and low network traffic.
2. Hub can be upgraded easily.
3. Easy to troubleshoot.
4. Easy to setup and modify.
5. Only that node is affected which has failed, rest of the nodes can work smoothly. Disadvantages of Star Topology
1. Cost of installation is high.
2. Expensive to use.
3. If the hub fails then the whole network is stopped because all the nodes depend on the hub.
4. Performance is based on the hub that is it depends on its capacity
MESH Topology
It is a point-to-point connection to other nodes or devices. All the network nodes are connected to each other. Mesh has n(n-2)/2 physical channels to link n devices.
There are two techniques to transmit data over the Mesh topology, they are :
1. Routing
2. Flooding
Types of Mesh Topology
1. Partial Mesh Topology : In this topology some of the systems are connected in the same fashion as mesh topology but some devices are only connected to two or three devices.
2. Full Mesh Topology : Each and every nodes or devices are connected to each other. Features of Mesh Topology
1. Fully connected.
2. Robust.
3. Not flexible. Advantages of Mesh Topology
1. Each connection can carry its own data load.
2. It is robust.
3. Fault is diagnosed easily.
4. Provides security and privacy. Disadvantages of Mesh Topology
1. Installation and configuration is difficult.
2. Cabling cost is more.
3. Bulk wiring is required.
TREE Topology
It has a root node and all other nodes are connected to it forming a hierarchy. It is also called hierarchical topology. It should at least have three levels to the hierarchy.
Features of Tree Topology
1. Ideal if workstations are located in groups.
2. Used in Wide Area Network. Advantages of Tree Topology
1. Extension of bus and star topologies.
2. Expansion of nodes is possible and easy.
3. Easily managed and maintained.
4. Error detection is easily done.
Disadvantages of Tree Topology
1. Heavily cabled.
2. Costly.
3. If more nodes are added maintenance is difficult.
4. Central hub fails, network fails.
HYBRID Topology
It is two different types of topologies which is a mixture of two or more topologies. For example if in an office in one department ring topology is used and in another star topology is used, connecting these topologies will result in Hybrid Topology (ring topology and star topology).
Features of Hybrid Topology
1. It is a combination of two or topologies
2. Inherits the advantages and disadvantages of the topologies included
Advantages of Hybrid Topology
1. Reliable as Error detecting and trouble shooting is easy.
2. Effective.
3. Scalable as size can be increased easily.
4. Flexible. Disadvantages of Hybrid Topology
1. Complex in design.
2. Costly.
Chapter -2
Data Communication & Computer Network
Definition of communication system: A system that exchange data between persons and equipment’s or device is called communication system. A communication system is made up of device that employee one of two communication method (Wireless or wired), different types of equipment (portable radios, mobile radios, base or fixed station and repeaters) and various accessories (speaker, microphone, battery eliminators) to meet the user needs.
Another definition of communication system: A system that exchange data between persons and equipment or device is called communication system
Data communication system: Data communication system is the function of transporting data from one point another.
Elements of data communication system: A data communication system has five fundamental elements, such as
i)Data source: Source is the computer where available data are obtained to send; examples are telephone and computers.
ii)Transmitter: The transmitter is the device that transmits the source data in the communication medium; example modem.
iii)Medium: The transmission medium is the physical path which a message travels from transmitter to receiver . It could be twisted pair wire, coaxial cable , fiber optic cable or radio waves.
iv)Receiver: It is the modem located at destination side that converts received data into computer readable form or in digital form.
v)Destination: The computer that finally store the incoming message or data is known as destination.
Fig: General Block diagram of Data communication Data transmission Speed
A term used to describe the data-handling capacity of a communications system is bandwidth. Bandwidth is the range of frequencies that is available for the transmission of data. The wider the bandwidth of a communications system, the more data it can transmit in a given period of time. Depending on the transmission speed, communication channels are grouped into three basic components-
A. Narrow Band: Narrow band channels range is speed from 45 to 300 bps. They are used for handling low data volumes and are fit for low-speed devices.
Example- Telegraph and low speed terminals.
B. Voice Band: Voice band channels can transmit data at speeds up to 9600 bps. They are so called because their major application is for ordinary telephone voice communication.
Example: Data transmission from card reader to CPU or from CPU to line printer.
C. Broad Band: Broad band or wide band channels are used when large volumes of data is to be transmitted at high speed. They system provide data transmission rate of 1 million bps or more.
Example: Use Optical fiber for data transmission.
2.3 Methods of data transmission: Data transmission method means how data is being transmitted from source to destination. Data transmission on a line is normally carried out in three different modes
i)Asynchronous Transmission:
ii) Synchronous Transmission:
iii) Isochronous Transmission
i)Asynchronous Transmission: Asynchronous transmission is often referred to as start-stop transmission because of its nature, that is, the sender can send a character at any time convenient and the receiver will accept it
Characteristics of Asynchronous transmission:
1. The sender can transmit the data any time and the receiver can receive the data at any time.
2. There is no necessity of primary storage device in transmission station.
3. Interval between characters may be uneven.
4. Less efficient and low speed.
5. A start bit and a stop bit is to send with each character.
6. The medium remains idle when there is no transmission of data.
Advantage of Asynchronous transmission:
The advantages of Asynchronous transmission is given below-
1. It is suitable for few amount of data transmission.
2. It does not requires any local storage at the terminal.
3. The cost is comparatively less then synchronous transmission
4. The sender can transmit the data any time and the receiver can receive the data at any time.
Disadvantage of Asynchronous transmission:
The disadvantage of Asynchronous transmission is given below-
1.The efficiency and speed is less then synchronous transmission.
2.It is does not use when there is no data transmission.
3. The cost of transmission is increased for microwave or satellite wave if transmission is closed.
4. Large overhead for start and stop bits.
5.Error handling usually more complex.
6. It does not support full-duplex data transmission.
ii) Synchronous Transmission: Synchronous transmission means that the bit stream is combined into longer “frames” which contain multiple bytes. Each byte is introduced onto the transmission link without a gap between it and the next one .Each frame contains 80 and 132 bytes data.
Characteristics of Synchronous Transmission:
1.There are no gaps between character being transmitted.
2.Efficiency is more.
3.Transmission speed is more.
4.Needs primary storage at sender station.
Advantage of Synchronous Transmission:
The advantages of Synchronous transmission is given below-
1.Lower overhead and thus, greater throughput.
2.Higher speeds then Asynchronous.
3.Error handling usually easy.
4.Support full-duplex data transmission.
5.It is suitable for large amount data transmission.
6.It is suitable for long distance data transmission. Disadvantage of Synchronous Transmission:
The disadvantages of Synchronous transmission is given below-
1.Slightly more complex.
2.Hardware is more expensive.
3.Service must be up and early
4.For correct operation the receiver must start to sample the line at the correct instant.
5.It needs a primary storage device in transmitter station.
Fig: Asynchronous and Synchronous transmission method
iii) Isochronous Transmission: An isochronous data transfer systems combines the feature of an asynchronous and synchronous data transfer system. An isochronous data transfer system sends blocks of data asynchronously, in other words the data stream can be transferred at random interval.
Each transmission begins with a start packet. Once the start packet is transmitted, the data must be delivered with a guaranteed bandwidth. Isochronous data transfer is commonly used for where data must be delivered within certain time constraints, like streaming video.
Transmission Modes in Computer Networks Transmission mode means transferring of data between two devices. It is also called communication mode. These modes direct the direction of flow of information. There are three types of transmission mode. They are : Simplex Mode Half duplex Mode Full duplex Mode
SIMPLEX Mode In this type of transmission mode data can be sent only through one direction i.e. communication is unidirectional. We cannot send a message back to the sender. Unidirectional communication is done in Simplex Systems. Examples of simplex Mode is loudspeaker, television broadcasting, television and remote, keyboard and monitor etc.
HALF DUPLEX Mode In half duplex system we can send data in both directions but it is done one at a time that is when the sender is sending the data then at that time we can’t send the sender our message. The data is sent in one direction. Example of half duplex is a walkie- talkie in which message is sent one at a time and messages are sent in both the directions.
FULL DUPLEX Mode In full duplex system we can send data in both directions as it is bidirectional. Data can be sent in both directions simultaneously. We can send as well as we receive the data. Example of Full Duplex is a Telephone Network in which there is communication between two persons by a telephone line, through which both can talk and listen at the same time. In full duplex system there can be two lines one for sending the data and the other for receiving data.
According to selection of path in network routing, data transmission mode can be divided into many ways:
Unicast
Broadcast
Multicast
Anycast
Geocast
Medium Of Data Communication
There are two categories of transmission media
Bounded/ Guided media
Unbounded/ Unguided
Bounded/Guided Transmission Media It is the transmission media in which signals are confined to a specific path using wire or cable. The types of Bounded/ Guided are discussed below.
Twisted Pair Cable This cable is the most commonly used and is cheaper than others. It is lightweight, cheap, can be installed easily, and they support many different types of network. Some important points : Its frequency range is 0 to 3.5 kHz. Typical attenuation is 0.2 dB/Km @ 1kHz. Typical delay is 50 μs/km. Repeater spacing is 2km. Twisted Pair is of two types : Unshielded Twisted Pair (UTP) Shielded Twisted Pair (STP)
Unshielded Twisted Pair Cable It is the most common type of telecommunication when compared with Shielded Twisted Pair Cable which consists of two conductors usually copper, each with its own color plastic insulator. Identification is the reason behind colored plastic insulation. UTP cables consist of 2 or 4 pairs of twisted cable. Cable with 2 pair use RJ-11 connector and 4 pair cable useRJ-45 connector. Advantages : Installation is easy Flexible Cheap It has high speed capacity, 100 meter limit Higher grades of UTP are used in LAN technologies like Ethernet. It consists of two insulating copper wires (1mm thick). The wires are twisted together in a helical form to reduce electrical interference from similar pair. Disadvantages : Bandwidth is low when compared with Coaxial Cable Provides less protection from interference.
Shielded Twisted Pair Cable This cable has a metal foil or braided-mesh covering which encases each pair of insulated conductors. Electromagnetic noise penetration is prevented by metal casing. Shielding also eliminates crosstalk (explained in KEY TERMS Chapter). It has same attenuation as unshielded twisted pair. It is faster the unshielded and coaxial cable. It is more expensive than coaxial and unshielded twisted pair. Advantages : Easy to install Performance is adequate Can be used for Analog or Digital transmission Increases the signalling rate Higher capacity than unshielded twisted pair Eliminates crosstalk Disadvantages : Difficult to manufacture Heavy
Coaxial Cable Coaxial is called by this name because it contains two conductors that are parallel to each other. Copper is used in this as centre conductor which can be a solid wire or a standard one. It is surrounded by PVC installation, a sheath which is encased in an outer conductor of metal foil, barid or both. Outer metallic wrapping is used as a shield against noise and as the second conductor which completes the circuit. The outer conductor is also encased in an insulating sheath. The outermost part is the plastic cover which protects the whole cable.
Advantages : Bandwidth is high Used in long distance telephone lines. Transmits digital signals at a very high rate of 10Mbps. Much higher noise immunity Data transmission without distortion.
The can span to longer distance at higher speeds as they have better shielding when compared to twisted pair cable Disadvantages : Single cable failure can fail the entire network. Difficult to install and expensive when compared with twisted pair. If the shield is imperfect, it can lead to grounded loop.
Fiber Optic Cable These are similar to coaxial cable. It uses electric signals to transmit data. At the centre is the glass core through which light propagates. In multimode fibres, the core is 50microns, and In single mode fibres, the thickness is 8 to 10 microns. The core in fiber optic cable is surrounded by glass cladding with lower index of refraction as compared to core to keep all the light in core. This is covered with a thin plastic jacket to protect the cladding. The fibers are grouped together in bundles protected by an outer shield. Fiber optic cable has bandwidth more than 2 gbps (Gigabytes per Second) Advantages :
Provides high quality transmission of signals at very high speed. These are not affected by electromagnetic interference, so noise and distortion is very less. Used for both analog and digital signals. Disadvantages : It is expensive Difficult to install. Maintenance is expensive and difficult. Do not allow complete routing of light signals. UnBounded/UnGuided Transmission Media Unguided or wireless media sends the data through air (or water), which is available to anyone who has a device capable of receiving them. Types of unguided/ unbounded media are discussed below : Radio Transmission MicroWave Transmission
Radio Transmission Its frequency is between 10 kHz to 1GHz. It is simple to install and has high attenuation. These waves are used for multicast communications. Types of Propogation Radio Transmission utilizes different types of propogation : Troposphere : The lowest portion of earth’s atmosphere extending outward approximately 30 miles from the earth’s surface. Clouds, jet planes, wind is found here.
Ionosphere : The layer of the atmosphere above troposphere, but below space. Contains electrically charged particles.
Microwave Transmission It travels at high frequency than the radio waves. It requires the sender to be inside of the receiver. It operates in a system with a low gigahertz range. It is mostly used for unicast communication. There are 2 types of Microwave Transmission : 1. Terrestrial Microwave 2. Satellite Microwave Advantages of Microwave Transmission Used for long distance telephone communication Carries 1000’s of voice channels at the same time Disadvantages of Microwave Transmission It is Very costly
Terrestrial Microwave For increasing the distance served by terrestrial microwave, repeaters can be installed with each antenna .The signal received by an antenna can be converted into transmittable form and relayed to next antenna as shown in below figure. It is an example of telephone systems all over the world
Satellite Microwave This is a microwave relay station which is placed in outer space. The satellites are launched either by rockets or space shuttles carry them. These are positioned 3600KM above the equator with an orbit speed that exactly matches the rotation speed of the earth. As the satellite is positioned in a geo-synchronous orbit, it is stationery relative to earth and always stays over the same point on the ground. This is usually done to allow ground stations to aim antenna at a fixed point in the sky. Features of Satellite Microwave :
Bandwidth capacity depends on the frequency used. Satellite microwave deployment for orbiting satellite is difficult. Advantages of Satellite Microwave : Transmitting station can receive back its own transmission and check whether the satellite has transmitted information correctly. A single microwave relay station which is visible from any point. Disadvantages of Satellite Microwave : Satellite manufacturing cost is very high Cost of launching satellite is very expensive Transmission highly depends on whether conditions, it can go down in bad weather Types of Communication Networks
Local Area Network (LAN) It is also called LAN and designed for small physical areas such as an office, group of buildings or a factory. LANs are used widely as it is easy to design and to troubleshoot.
Personal computers and workstations are connected to each other through LANs. We can use different types of topologies through LAN, these are Star, Ring, Bus, Tree etc. LAN can be a simple network like connecting two computers, to share files and network among each other while it can also be as complex as interconnecting an entire building. LAN networks are also widely used to share resources like printers, shared hard-drive etc. Applications of LAN One of the computer in a network can become a server serving all the remaining computers called clients. Software can be stored on the server and it can be used by the remaining clients. Connecting Locally all the workstations in a building to let them communicate with each other locally without any internet access. Sharing common resources like printers etc are some common applications of LAN.
Metropolitan Area Network (MAN) It is basically a bigger version of LAN. It is also called MAN and uses the similar technology as LAN. It is designed to extend over the entire city. It can be means to
connecting a number of LANs into a larger network or it can be a single cable. It is mainly hold and operated by single private company or a public company.
Wide Area Network (WAN) It is also called WAN. WAN can be private or it can be public leased network. It is used for the network that covers large distance such as cover states of a country. It is not easy to design and maintain. Communication medium used by WAN are PSTN or Satellite links. WAN operates on low data rates.
Wireless Network It is the fastest growing segment of computer. They are becoming very important in our daily life because wind connections are not possible in cars or aeroplane. We can access Internet at any place avoiding wire related troubles.. These can be used also when the telephone systems gets destroyed due to some calamity/disaster. WANs are really important now-a-days.
Types of Network Topology
Network Topology is the schematic description of a network arrangement, connecting various nodes(sender and receiver) through lines of connection.
BUS Topology
Bus topology is a network type in which every computer and network device is connected to single cable. When it has exactly two endpoints, then it is called Linear Bus topology.
Features of Bus Topology
1. It transmits data only in one direction.
2. Every device is connected to a single cable Advantages of Bus Topology
1. It is cost effective.
2. Cable required is least compared to other network topology.
3. Used in small networks.
4. It is easy to understand.
5. Easy to expand joining two cables together. Disadvantages of Bus Topology
1. Cables fails then whole network fails.
2. If network traffic is heavy or nodes are more the performance of the network decreases.
3. Cable has a limited length.
4. It is slower than the ring topology.
RING Topology
It is called ring topology because it forms a ring as each computer is connected to another computer, with the last one connected to the first. Exactly two neighbours for each device.
Features of Ring Topology
1. A number of repeaters are used for Ring topology with large number of nodes, because if someone wants to send some data to the last node in the ring topology with 100 nodes, then the data will have to pass through 99 nodes to reach the 100th node. Hence to prevent data loss repeaters are used in the network.
2. The transmission is unidirectional, but it can be made bidirectional by having 2 connections between each Network Node, it is called Dual Ring Topology.
3. In Dual Ring Topology, two ring networks are formed, and data flow is in opposite direction in them. Also, if one ring fails, the second ring can act as a backup, to keep the network up.
4. Data is transferred in a sequential manner that is bit by bit. Data transmitted, has to pass through each node of the network, till the destination node. Advantages of Ring Topology
1. Transmitting network is not affected by high traffic or by adding more nodes, as only the nodes having tokens can transmit data.
2. Cheap to install and expand Disadvantages of Ring Topology
1. Troubleshooting is difficult in ring topology.
2. Adding or deleting the computers disturbs the network activity.
3. Failure of one computer disturbs the whole network.
STAR Topology
In this type of topology all the computers are connected to a single hub through a cable. This hub is the central node and all others nodes are connected to the central node.
Features of Star Topology
1. Every node has its own dedicated connection to the hub.
2. Hub acts as a repeater for data flow.
3. Can be used with twisted pair, Optical Fiber or coaxial cable. Advantages of Star Topology
1. Fast performance with few nodes and low network traffic.
2. Hub can be upgraded easily.
3. Easy to troubleshoot.
4. Easy to setup and modify.
5. Only that node is affected which has failed, rest of the nodes can work smoothly. Disadvantages of Star Topology
1. Cost of installation is high.
2. Expensive to use.
3. If the hub fails then the whole network is stopped because all the nodes depend on the hub.
4. Performance is based on the hub that is it depends on its capacity
MESH Topology
It is a point-to-point connection to other nodes or devices. All the network nodes are connected to each other. Mesh has n(n-2)/2 physical channels to link n devices.
There are two techniques to transmit data over the Mesh topology, they are :
1. Routing
2. Flooding
Types of Mesh Topology
1. Partial Mesh Topology : In this topology some of the systems are connected in the same fashion as mesh topology but some devices are only connected to two or three devices.
2. Full Mesh Topology : Each and every nodes or devices are connected to each other. Features of Mesh Topology
1. Fully connected.
2. Robust.
3. Not flexible. Advantages of Mesh Topology
1. Each connection can carry its own data load.
2. It is robust.
3. Fault is diagnosed easily.
4. Provides security and privacy. Disadvantages of Mesh Topology
1. Installation and configuration is difficult.
2. Cabling cost is more.
3. Bulk wiring is required.
TREE Topology
It has a root node and all other nodes are connected to it forming a hierarchy. It is also called hierarchical topology. It should at least have three levels to the hierarchy.
Features of Tree Topology
1. Ideal if workstations are located in groups.
2. Used in Wide Area Network. Advantages of Tree Topology
1. Extension of bus and star topologies.
2. Expansion of nodes is possible and easy.
3. Easily managed and maintained.
4. Error detection is easily done.
Disadvantages of Tree Topology
1. Heavily cabled.
2. Costly.
3. If more nodes are added maintenance is difficult.
4. Central hub fails, network fails.
HYBRID Topology
It is two different types of topologies which is a mixture of two or more topologies. For example if in an office in one department ring topology is used and in another star topology is used, connecting these topologies will result in Hybrid Topology (ring topology and star topology).
Features of Hybrid Topology
1. It is a combination of two or topologies
2. Inherits the advantages and disadvantages of the topologies included
Advantages of Hybrid Topology
1. Reliable as Error detecting and trouble shooting is easy.
2. Effective.
3. Scalable as size can be increased easily.
4. Flexible. Disadvantages of Hybrid Topology
1. Complex in design.
2. Costly.
Subscribe to:
Posts (Atom)
















